Incidental Mutation 'R4211:Casp3'
ID319197
Institutional Source Beutler Lab
Gene Symbol Casp3
Ensembl Gene ENSMUSG00000031628
Gene Namecaspase 3
Synonymsmldy, Yama, Caspase-3, Apopain, CPP32, A830040C14Rik, CC3, AC-3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location46617291-46639689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46635388 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 107 (D107Y)
Ref Sequence ENSEMBL: ENSMUSP00000147767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093517] [ENSMUST00000210534] [ENSMUST00000211115]
Predicted Effect probably damaging
Transcript: ENSMUST00000093517
AA Change: D107Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091238
Gene: ENSMUSG00000031628
AA Change: D107Y

DomainStartEndE-ValueType
CASc 36 277 9.95e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209668
Predicted Effect probably benign
Transcript: ENSMUST00000210534
Predicted Effect probably damaging
Transcript: ENSMUST00000211115
AA Change: D107Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to a highly conserved family of cysteinyl aspartate-specific proteases that function as essential regulators of programmed cell death through apoptosis. Members of this family contain an N-terminal pro-domain and require cleavage at specific aspartate residues to become mature. The protein encoded by this gene belongs to a subgroup of cysteinyl aspartate-specific proteases that are activated by initiator caspases and that perform the proteolytic cleavage of apoptotic target proteins. Mice defective for this gene exhibit a variety of phenotypes including reduced neuronal apoptosis resulting in hyperplasias, hearing loss, attenuated osteogenic differentiation of bone marrow stromal stem cells, and pre- and post-natal lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Some homozygous animals show defects in brain development by embryonic day 12, reduced neuronal apoptosis causing hyperplasias, and pre- and postnatal lethality. Other homozygous animals exhibit only hearing loss, inner ear defects and degeneration of spiral ganglion neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Casp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Casp3 APN 8 46629741 utr 5 prime probably benign
warner UTSW 8 46635388 missense probably damaging 1.00
R0601:Casp3 UTSW 8 46636227 missense probably benign 0.00
R1541:Casp3 UTSW 8 46634334 missense probably benign 0.02
R1648:Casp3 UTSW 8 46638074 missense probably benign
R2046:Casp3 UTSW 8 46629726 splice site probably benign
R2159:Casp3 UTSW 8 46634288 missense probably damaging 1.00
R2176:Casp3 UTSW 8 46629756 missense probably damaging 1.00
R2251:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2252:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2253:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R4095:Casp3 UTSW 8 46634216 missense probably damaging 1.00
R4209:Casp3 UTSW 8 46635388 missense probably damaging 1.00
R4868:Casp3 UTSW 8 46634279 missense probably benign 0.01
R5713:Casp3 UTSW 8 46636314 missense probably damaging 1.00
R6847:Casp3 UTSW 8 46636266 missense probably benign 0.00
R6957:Casp3 UTSW 8 46634273 missense probably damaging 1.00
R7196:Casp3 UTSW 8 46635463 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGCATCTTCATCTTGTCATGG -3'
(R):5'- GTTAACCAAACTGAGCACCGAG -3'

Sequencing Primer
(F):5'- TGTCATGGTATAACAGTAACCCCAG -3'
(R):5'- GAGCTGCTGGGCAATGC -3'
Posted On2015-06-10