Incidental Mutation 'R4211:Tango6'
ID319199
Institutional Source Beutler Lab
Gene Symbol Tango6
Ensembl Gene ENSMUSG00000041949
Gene Nametransport and golgi organization 6
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106683068-106851439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106689224 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 226 (I226V)
Ref Sequence ENSEMBL: ENSMUSP00000148400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048359] [ENSMUST00000211979]
Predicted Effect probably benign
Transcript: ENSMUST00000048359
AA Change: I226V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000043953
Gene: ENSMUSG00000041949
AA Change: I226V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 20 41 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
Pfam:RTP1_C1 824 935 1.6e-35 PFAM
low complexity region 998 1013 N/A INTRINSIC
Pfam:RTP1_C2 1026 1059 7.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211979
AA Change: I226V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212764
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Tango6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tango6 APN 8 106742472 critical splice donor site probably null
IGL00925:Tango6 APN 8 106695445 splice site probably benign
IGL00965:Tango6 APN 8 106742010 splice site probably benign
IGL01412:Tango6 APN 8 106818499 missense probably benign 0.02
IGL02888:Tango6 APN 8 106720665 missense probably damaging 1.00
IGL02892:Tango6 APN 8 106742010 splice site probably benign
R0241:Tango6 UTSW 8 106747361 splice site probably benign
R0494:Tango6 UTSW 8 106735682 splice site probably benign
R1127:Tango6 UTSW 8 106688895 missense probably benign 0.00
R1440:Tango6 UTSW 8 106689039 missense probably damaging 1.00
R1547:Tango6 UTSW 8 106781786 missense probably damaging 0.98
R1921:Tango6 UTSW 8 106688794 missense probably benign 0.06
R2255:Tango6 UTSW 8 106689294 critical splice donor site probably null
R2761:Tango6 UTSW 8 106699032 missense possibly damaging 0.93
R4463:Tango6 UTSW 8 106689074 missense probably benign 0.29
R4696:Tango6 UTSW 8 106700231 missense possibly damaging 0.73
R4867:Tango6 UTSW 8 106818526 missense probably damaging 1.00
R4946:Tango6 UTSW 8 106718090 nonsense probably null
R5459:Tango6 UTSW 8 106850289 missense probably damaging 1.00
R5522:Tango6 UTSW 8 106695598 critical splice donor site probably null
R5795:Tango6 UTSW 8 106718077 missense probably damaging 1.00
R5878:Tango6 UTSW 8 106689168 missense possibly damaging 0.77
R6318:Tango6 UTSW 8 106818497 missense probably benign
R6335:Tango6 UTSW 8 106692676 missense possibly damaging 0.94
R6633:Tango6 UTSW 8 106718005 missense probably benign 0.00
R6664:Tango6 UTSW 8 106742114 missense probably damaging 1.00
R6838:Tango6 UTSW 8 106742074 missense probably benign 0.00
R6866:Tango6 UTSW 8 106742472 critical splice donor site probably null
R7046:Tango6 UTSW 8 106807116 missense possibly damaging 0.86
R7130:Tango6 UTSW 8 106807101 missense probably damaging 1.00
R7199:Tango6 UTSW 8 106689159 missense probably benign 0.01
R7418:Tango6 UTSW 8 106688834 missense probably benign 0.26
R7480:Tango6 UTSW 8 106696727 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTGTAGTCACCTTGGGCGTC -3'
(R):5'- GCTTGGCATTAGACAGAAATTCTCTC -3'

Sequencing Primer
(F):5'- TACCTCATTCCTGGCGTGGG -3'
(R):5'- ATGAGCCACCATGTGATTGC -3'
Posted On2015-06-10