Incidental Mutation 'R4211:Urgcp'
ID319205
Institutional Source Beutler Lab
Gene Symbol Urgcp
Ensembl Gene ENSMUSG00000049680
Gene Nameupregulator of cell proliferation
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5713417-5762376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5715878 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 820 (G820V)
Ref Sequence ENSEMBL: ENSMUSP00000133216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053427] [ENSMUST00000093362] [ENSMUST00000118076] [ENSMUST00000120306] [ENSMUST00000140922] [ENSMUST00000170116]
Predicted Effect probably damaging
Transcript: ENSMUST00000053427
AA Change: G820V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055821
Gene: ENSMUSG00000049680
AA Change: G820V

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093362
AA Change: G863V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091053
Gene: ENSMUSG00000049680
AA Change: G863V

DomainStartEndE-ValueType
Blast:PGAM 15 752 N/A BLAST
SCOP:d1h65a_ 670 761 1e-3 SMART
coiled coil region 899 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118076
AA Change: G820V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113589
Gene: ENSMUSG00000049680
AA Change: G820V

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120306
AA Change: G820V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113060
Gene: ENSMUSG00000049680
AA Change: G820V

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140922
SMART Domains Protein: ENSMUSP00000120902
Gene: ENSMUSG00000049680

DomainStartEndE-ValueType
Blast:PGAM 1 99 7e-43 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149980
Predicted Effect probably damaging
Transcript: ENSMUST00000170116
AA Change: G820V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133216
Gene: ENSMUSG00000049680
AA Change: G820V

DomainStartEndE-ValueType
Blast:PGAM 1 709 N/A BLAST
SCOP:d1h65a_ 627 718 1e-3 SMART
coiled coil region 856 883 N/A INTRINSIC
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] URG4 is upregulated in the presence of hepatitis B virus (HBV)-encoded X antigen (HBxAg) and may contribute to the development of hepatocellular carcinoma by promoting hepatocellular growth and survival (Tufan et al., 2002 [PubMed 12082552]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Urgcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Urgcp APN 11 5716448 missense possibly damaging 0.94
IGL01832:Urgcp APN 11 5717325 missense probably damaging 0.99
IGL02299:Urgcp APN 11 5717573 missense probably damaging 1.00
IGL02519:Urgcp APN 11 5717745 missense probably benign 0.02
IGL02616:Urgcp APN 11 5717400 missense probably damaging 0.99
IGL02619:Urgcp APN 11 5715752 missense possibly damaging 0.87
IGL03135:Urgcp APN 11 5716091 missense possibly damaging 0.79
IGL03209:Urgcp APN 11 5717238 unclassified probably null
PIT4305001:Urgcp UTSW 11 5717996 missense probably damaging 1.00
R0279:Urgcp UTSW 11 5716989 missense probably benign 0.14
R0555:Urgcp UTSW 11 5717477 missense probably damaging 1.00
R1110:Urgcp UTSW 11 5716004 missense probably benign 0.09
R1595:Urgcp UTSW 11 5717447 missense probably damaging 1.00
R1808:Urgcp UTSW 11 5717242 missense probably damaging 1.00
R1891:Urgcp UTSW 11 5716910 missense probably benign 0.43
R1993:Urgcp UTSW 11 5716526 missense probably damaging 1.00
R3155:Urgcp UTSW 11 5716327 missense probably damaging 1.00
R3769:Urgcp UTSW 11 5717000 missense probably damaging 1.00
R4209:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R4210:Urgcp UTSW 11 5715878 missense probably damaging 0.99
R5335:Urgcp UTSW 11 5717754 missense possibly damaging 0.66
R6242:Urgcp UTSW 11 5716691 missense probably benign 0.34
R6971:Urgcp UTSW 11 5718115 missense probably benign 0.34
R7411:Urgcp UTSW 11 5718116 missense probably benign 0.10
R7460:Urgcp UTSW 11 5716622 missense possibly damaging 0.88
X0005:Urgcp UTSW 11 5718231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGTCACACCAGTCACAG -3'
(R):5'- AGCTGTTCTTCATGCGTTTCTAAGG -3'

Sequencing Primer
(F):5'- ACCAGTCACAGCCTGCG -3'
(R):5'- CCAGAACCTTCATGACCT -3'
Posted On2015-06-10