Incidental Mutation 'R4211:Smarcd2'
ID319208
Institutional Source Beutler Lab
Gene Symbol Smarcd2
Ensembl Gene ENSMUSG00000078619
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
SynonymsBaf60b
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106263179-106272972 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 106266905 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 138 (K138*)
Ref Sequence ENSEMBL: ENSMUSP00000102456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021049] [ENSMUST00000021052] [ENSMUST00000106843] [ENSMUST00000133131] [ENSMUST00000140255]
Predicted Effect probably benign
Transcript: ENSMUST00000021049
SMART Domains Protein: ENSMUSP00000021049
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021052
AA Change: K185*
SMART Domains Protein: ENSMUSP00000021052
Gene: ENSMUSG00000078619
AA Change: K185*

DomainStartEndE-ValueType
low complexity region 5 42 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 122 131 N/A INTRINSIC
Blast:KISc 136 287 2e-36 BLAST
SWIB 307 386 1.3e-21 SMART
Blast:MYSc 468 514 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106841
Predicted Effect probably null
Transcript: ENSMUST00000106843
AA Change: K138*
SMART Domains Protein: ENSMUSP00000102456
Gene: ENSMUSG00000078619
AA Change: K138*

DomainStartEndE-ValueType
low complexity region 75 84 N/A INTRINSIC
Blast:KISc 89 240 1e-36 BLAST
SWIB 260 339 1.3e-21 SMART
Blast:MYSc 421 467 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132278
Predicted Effect probably benign
Transcript: ENSMUST00000133131
SMART Domains Protein: ENSMUSP00000138057
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140255
SMART Domains Protein: ENSMUSP00000133629
Gene: ENSMUSG00000078619

DomainStartEndE-ValueType
SWIB 29 108 1.3e-21 SMART
Blast:MYSc 190 236 6e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174253
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Smarcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Smarcd2 APN 11 106265904 missense probably damaging 1.00
IGL01880:Smarcd2 APN 11 106266677 missense probably damaging 1.00
R0357:Smarcd2 UTSW 11 106267332 critical splice donor site probably null
R0626:Smarcd2 UTSW 11 106267415 missense probably benign 0.10
R1524:Smarcd2 UTSW 11 106267152 missense probably benign 0.01
R1822:Smarcd2 UTSW 11 106267396 missense probably benign 0.00
R2072:Smarcd2 UTSW 11 106265307 nonsense probably null
R2074:Smarcd2 UTSW 11 106265307 nonsense probably null
R2359:Smarcd2 UTSW 11 106267164 missense probably benign 0.01
R3960:Smarcd2 UTSW 11 106266575 missense probably damaging 1.00
R4258:Smarcd2 UTSW 11 106265250 missense probably damaging 1.00
R4822:Smarcd2 UTSW 11 106266531 splice site probably null
R5174:Smarcd2 UTSW 11 106267045 unclassified probably benign
R6035:Smarcd2 UTSW 11 106266889 critical splice donor site probably null
R6035:Smarcd2 UTSW 11 106266889 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGCCATATGTAGCAAGACACC -3'
(R):5'- GAAGATGGCAGATAAGGTTCTACC -3'

Sequencing Primer
(F):5'- CATTTCAAAGCACGCTAAAGTGAGTG -3'
(R):5'- GGTTCTACCTCAGCGAGTG -3'
Posted On2015-06-10