Incidental Mutation 'R4211:Tdp1'
ID319209
Institutional Source Beutler Lab
Gene Symbol Tdp1
Ensembl Gene ENSMUSG00000021177
Gene Nametyrosyl-DNA phosphodiesterase 1
SynonymsE430034L06Rik, 2810481F14Rik, SCAN1, 4921509N21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location99884517-99955219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99898329 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 243 (A243E)
Ref Sequence ENSEMBL: ENSMUSP00000118656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021594] [ENSMUST00000153627]
Predicted Effect probably damaging
Transcript: ENSMUST00000021594
AA Change: A243E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021594
Gene: ENSMUSG00000021177
AA Change: A243E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Pfam:Tyr-DNA_phospho 164 583 2.7e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151019
Predicted Effect probably damaging
Transcript: ENSMUST00000153627
AA Change: A243E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118656
Gene: ENSMUSG00000021177
AA Change: A243E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
Pfam:Tyr-DNA_phospho 166 583 2.4e-142 PFAM
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in repairing stalled topoisomerase I-DNA complexes by catalyzing the hydrolysis of the phosphodiester bond between the tyrosine residue of topoisomerase I and the 3-prime phosphate of DNA. This protein may also remove glycolate from single-stranded DNA containing 3-prime phosphoglycolate, suggesting a role in repair of free-radical mediated DNA double-strand breaks. This gene is a member of the phospholipase D family and contains two PLD phosphodiesterase domains. Mutations in this gene are associated with the disease spinocerebellar ataxia with axonal neuropathy (SCAN1). [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit defective single strand DNA repair in neurons, decreased cerebellum size and increased sensitivity to topotecan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Top3b A G 16: 16,882,532 probably null Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Tdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Tdp1 APN 12 99893648 missense possibly damaging 0.79
IGL01099:Tdp1 APN 12 99915445 splice site probably benign
IGL01295:Tdp1 APN 12 99891670 missense probably benign 0.00
IGL01409:Tdp1 APN 12 99909681 missense possibly damaging 0.83
IGL01482:Tdp1 APN 12 99891380 missense probably benign
IGL03116:Tdp1 APN 12 99955031 missense probably benign 0.27
R0008:Tdp1 UTSW 12 99954958 splice site probably benign
R0033:Tdp1 UTSW 12 99935052 missense probably benign 0.30
R0092:Tdp1 UTSW 12 99954989 missense probably damaging 1.00
R0485:Tdp1 UTSW 12 99909842 missense probably benign 0.30
R0611:Tdp1 UTSW 12 99909711 missense probably benign
R0853:Tdp1 UTSW 12 99935067 missense probably damaging 0.96
R1539:Tdp1 UTSW 12 99912312 missense probably damaging 1.00
R1692:Tdp1 UTSW 12 99955001 missense probably damaging 1.00
R1751:Tdp1 UTSW 12 99891343 unclassified probably null
R1767:Tdp1 UTSW 12 99891343 unclassified probably null
R3788:Tdp1 UTSW 12 99891752 splice site probably benign
R3790:Tdp1 UTSW 12 99891752 splice site probably benign
R3837:Tdp1 UTSW 12 99894708 critical splice acceptor site probably null
R3917:Tdp1 UTSW 12 99894717 missense probably damaging 1.00
R4209:Tdp1 UTSW 12 99898329 missense probably damaging 1.00
R4509:Tdp1 UTSW 12 99955065 utr 3 prime probably benign
R4774:Tdp1 UTSW 12 99902364 missense possibly damaging 0.56
R4859:Tdp1 UTSW 12 99909811 missense probably benign 0.20
R5229:Tdp1 UTSW 12 99893660 missense probably damaging 1.00
R5348:Tdp1 UTSW 12 99915506 missense probably damaging 1.00
R5441:Tdp1 UTSW 12 99910285 missense probably damaging 1.00
R5457:Tdp1 UTSW 12 99894746 nonsense probably null
R5685:Tdp1 UTSW 12 99902352 missense possibly damaging 0.51
R6329:Tdp1 UTSW 12 99914071 missense probably damaging 0.99
R6329:Tdp1 UTSW 12 99914072 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGAAGTAATGAGTGAGCCCC -3'
(R):5'- TGGCATGAGTTACTTGAGCC -3'

Sequencing Primer
(F):5'- AGTCACTGCATGATGTCAGC -3'
(R):5'- GCATGAGTTACTTGAGCCACAATAAG -3'
Posted On2015-06-10