Incidental Mutation 'R4211:Top3b'
ID319216
Institutional Source Beutler Lab
Gene Symbol Top3b
Ensembl Gene ENSMUSG00000022779
Gene Nametopoisomerase (DNA) III beta
SynonymsTopo III beta
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R4211 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16870736-16892990 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 16882532 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023465] [ENSMUST00000119787] [ENSMUST00000139740] [ENSMUST00000156502] [ENSMUST00000231812] [ENSMUST00000232017] [ENSMUST00000232080] [ENSMUST00000232200] [ENSMUST00000232231] [ENSMUST00000232547] [ENSMUST00000232581]
Predicted Effect probably benign
Transcript: ENSMUST00000023465
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023465
Gene: ENSMUSG00000022779
AA Change: N139S

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118424
Predicted Effect probably benign
Transcript: ENSMUST00000119787
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112913
Gene: ENSMUSG00000022779
AA Change: N139S

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
TOP1Ac 289 545 2.28e-104 SMART
low complexity region 824 850 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125202
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138618
Predicted Effect probably benign
Transcript: ENSMUST00000139740
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118398
Gene: ENSMUSG00000022779
AA Change: N139S

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 242 3.84e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150424
Predicted Effect probably benign
Transcript: ENSMUST00000156502
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115491
Gene: ENSMUSG00000022779
AA Change: N139S

DomainStartEndE-ValueType
TOPRIM 3 138 2.64e-27 SMART
TOP1Bc 146 234 4.29e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231576
Predicted Effect probably benign
Transcript: ENSMUST00000231812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231834
Predicted Effect probably benign
Transcript: ENSMUST00000232017
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232080
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably null
Transcript: ENSMUST00000232117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232153
Predicted Effect probably benign
Transcript: ENSMUST00000232200
Predicted Effect probably benign
Transcript: ENSMUST00000232231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232531
Predicted Effect probably benign
Transcript: ENSMUST00000232547
Predicted Effect probably benign
Transcript: ENSMUST00000232581
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232656
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Low expression of this gene may be related to higher survival rates in breast cancer patients. This gene has a pseudogene on chromosome 22. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice develop to maturity but die prematurely showing enlargement of lymphatic organs and glomerulonephritis. Intercrossing of mutant mice progressively results in infertility that is correlated to increased aneuploidy in germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T G 5: 90,564,237 V63G probably damaging Het
Adgb T C 10: 10,407,465 I166V probably benign Het
Anapc5 T C 5: 122,817,905 E154G probably benign Het
Anpep A T 7: 79,840,996 Y257* probably null Het
Atp8b1 A T 18: 64,553,047 D688E probably damaging Het
Bub1b C A 2: 118,630,978 H670Q possibly damaging Het
Casp3 G T 8: 46,635,388 D107Y probably damaging Het
Clcc1 A T 3: 108,663,591 Y105F possibly damaging Het
Cr2 A C 1: 195,156,328 L671R probably damaging Het
Cttnbp2 A G 6: 18,427,543 V713A probably damaging Het
Cyp4a31 T C 4: 115,565,013 F65L probably benign Het
Dpysl2 T C 14: 66,815,477 S308G probably damaging Het
Dusp22 A T 13: 30,708,743 I168F probably benign Het
Ecel1 A G 1: 87,152,150 S414P probably damaging Het
Fat2 A G 11: 55,283,984 F1968L probably damaging Het
Fsip2 C T 2: 82,975,149 T604I probably damaging Het
Gatsl2 T C 5: 134,125,944 probably null Het
H2-DMb1 T A 17: 34,155,573 F66I possibly damaging Het
Hgf T C 5: 16,614,993 V574A probably damaging Het
Hoxa7 A T 6: 52,216,625 Y137* probably null Het
Ikbke T A 1: 131,263,348 I519F probably damaging Het
Inpp5j T G 11: 3,501,107 H514P probably damaging Het
Kmt2d A G 15: 98,840,189 probably benign Het
Larp7 T A 3: 127,546,954 R112S probably benign Het
Lepr C T 4: 101,733,414 A63V probably benign Het
Lmx1a G T 1: 167,832,859 V238L probably damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mcmbp T C 7: 128,716,005 E172G possibly damaging Het
Mcpt8 G A 14: 56,083,918 H30Y probably damaging Het
Nek8 C A 11: 78,170,483 V379L probably benign Het
Numa1 T G 7: 102,009,738 L356R probably damaging Het
Pard6b C T 2: 168,099,023 A310V probably benign Het
Pcgf5 C A 19: 36,437,340 N26K possibly damaging Het
Phtf1 G A 3: 104,003,603 probably null Het
Plch1 C A 3: 63,711,219 D675Y probably damaging Het
Plk2 A G 13: 110,396,337 H144R probably damaging Het
Rax T A 18: 65,935,081 N318Y unknown Het
Slc9a5 A G 8: 105,358,471 N535D possibly damaging Het
Smarcd2 T A 11: 106,266,905 K138* probably null Het
Taar7e A T 10: 24,038,034 I141F probably damaging Het
Taar7f T A 10: 24,050,023 W172R probably damaging Het
Tango6 A G 8: 106,689,224 I226V probably benign Het
Tcn2 T C 11: 3,922,114 K338E possibly damaging Het
Tdp1 C A 12: 99,898,329 A243E probably damaging Het
Tfpt A G 7: 3,620,387 Y240H probably damaging Het
Tmod4 A G 3: 95,127,829 D215G probably benign Het
Urgcp C A 11: 5,715,878 G820V probably damaging Het
Zfand2b A T 1: 75,169,810 M110L probably benign Het
Zfyve1 A T 12: 83,575,135 V162E probably damaging Het
Other mutations in Top3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Top3b APN 16 16887622 missense probably damaging 0.97
IGL01512:Top3b APN 16 16891422 missense possibly damaging 0.74
IGL01552:Top3b APN 16 16887823 splice site probably benign
IGL01738:Top3b APN 16 16880604 missense probably benign 0.04
IGL02090:Top3b APN 16 16891470 missense possibly damaging 0.81
R0143:Top3b UTSW 16 16883525 missense probably damaging 0.97
R0883:Top3b UTSW 16 16879437 splice site probably benign
R1386:Top3b UTSW 16 16880629 missense probably benign 0.29
R1440:Top3b UTSW 16 16892777 nonsense probably null
R1958:Top3b UTSW 16 16884302 missense possibly damaging 0.52
R1970:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4292:Top3b UTSW 16 16883519 missense probably damaging 1.00
R4307:Top3b UTSW 16 16889617 splice site probably benign
R4832:Top3b UTSW 16 16890662 nonsense probably null
R5047:Top3b UTSW 16 16891418 missense probably benign 0.00
R5364:Top3b UTSW 16 16886970 missense probably benign 0.00
R5590:Top3b UTSW 16 16891577 intron probably benign
R5604:Top3b UTSW 16 16889535 nonsense probably null
R5719:Top3b UTSW 16 16885836 missense probably damaging 1.00
R5969:Top3b UTSW 16 16883565 critical splice donor site probably null
R6018:Top3b UTSW 16 16892892 missense probably damaging 1.00
R6144:Top3b UTSW 16 16879141 unclassified probably null
R6155:Top3b UTSW 16 16891509 missense probably damaging 1.00
R6341:Top3b UTSW 16 16879071 missense probably damaging 0.98
R6700:Top3b UTSW 16 16892669 missense possibly damaging 0.48
R7417:Top3b UTSW 16 16877850 start gained probably benign
X0011:Top3b UTSW 16 16890189 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATATCTGGAAGGGAGTGC -3'
(R):5'- GAACAGCACCTAGTGAATGCAC -3'

Sequencing Primer
(F):5'- ACCCAGGTTGCAAGGGATTTC -3'
(R):5'- TGAATGCACAGCCGATGC -3'
Posted On2015-06-10