Mutagenetix > Incidental Mutation

Incidental Mutation 'R4211:Top3b'

319216

Institutional Source

Beutler Lab

Gene Symbol

Top3b

Ensembl Gene

ENSMUSG00000022779

Gene Name

topoisomerase (DNA) III beta

Synonyms

Topo III beta

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R4211 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16688600-16710854 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 16700396 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023465] [ENSMUST00000119787] [ENSMUST00000156502] [ENSMUST00000139740] [ENSMUST00000232017] [ENSMUST00000232080] [ENSMUST00000231812] [ENSMUST00000232200] [ENSMUST00000232581] [ENSMUST00000232547] [ENSMUST00000232231]

AlphaFold

Q9Z321

Predicted Effect

probably benign
Transcript: ENSMUST00000023465
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000023465
Gene: ENSMUSG00000022779
AA Change: N139S

Domain	Start	End	E-Value	Type
TOPRIM	3	138	2.64e-27	SMART
TOP1Bc	146	242	3.84e-38	SMART
TOP1Ac	289	545	2.28e-104	SMART
low complexity region	824	850	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118424

Predicted Effect

probably benign
Transcript: ENSMUST00000119787
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112913
Gene: ENSMUSG00000022779
AA Change: N139S

Domain	Start	End	E-Value	Type
TOPRIM	3	138	2.64e-27	SMART
TOP1Bc	146	242	3.84e-38	SMART
TOP1Ac	289	545	2.28e-104	SMART
low complexity region	824	850	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125202

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129969

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135597

Predicted Effect

probably benign
Transcript: ENSMUST00000156502
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000115491
Gene: ENSMUSG00000022779
AA Change: N139S

Domain	Start	End	E-Value	Type
TOPRIM	3	138	2.64e-27	SMART
TOP1Bc	146	234	4.29e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139740
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118398
Gene: ENSMUSG00000022779
AA Change: N139S

Domain	Start	End	E-Value	Type
TOPRIM	3	138	2.64e-27	SMART
TOP1Bc	146	242	3.84e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150424

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138618

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147531

Predicted Effect

probably benign
Transcript: ENSMUST00000232017
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000232080
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232153

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231576

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231278

Predicted Effect

probably null
Transcript: ENSMUST00000232117

Predicted Effect

probably benign
Transcript: ENSMUST00000231812

Predicted Effect

probably benign
Transcript: ENSMUST00000232200

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231834

Predicted Effect

probably benign
Transcript: ENSMUST00000232581
AA Change: N139S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000232547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232531

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232380

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232656

Predicted Effect

probably benign
Transcript: ENSMUST00000232231

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus relaxing the supercoils and altering the topology of DNA. The enzyme interacts with DNA helicase SGS1 and plays a role in DNA recombination, cellular aging and maintenance of genome stability. Low expression of this gene may be related to higher survival rates in breast cancer patients. This gene has a pseudogene on chromosome 22. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice develop to maturity but die prematurely showing enlargement of lymphatic organs and glomerulonephritis. Intercrossing of mutant mice progressively results in infertility that is correlated to increased aneuploidy in germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	C	10: 10,283,209 (GRCm39)	I166V	probably benign	Het
Albfm1	T	G	5: 90,712,096 (GRCm39)	V63G	probably damaging	Het
Anapc5	T	C	5: 122,955,968 (GRCm39)	E154G	probably benign	Het
Anpep	A	T	7: 79,490,744 (GRCm39)	Y257*	probably null	Het
Atp8b1	A	T	18: 64,686,118 (GRCm39)	D688E	probably damaging	Het
Bub1b	C	A	2: 118,461,459 (GRCm39)	H670Q	possibly damaging	Het
Casp3	G	T	8: 47,088,423 (GRCm39)	D107Y	probably damaging	Het
Castor2	T	C	5: 134,154,783 (GRCm39)		probably null	Het
Clcc1	A	T	3: 108,570,907 (GRCm39)	Y105F	possibly damaging	Het
Cr2	A	C	1: 194,838,636 (GRCm39)	L671R	probably damaging	Het
Cttnbp2	A	G	6: 18,427,542 (GRCm39)	V713A	probably damaging	Het
Cyp4a31	T	C	4: 115,422,210 (GRCm39)	F65L	probably benign	Het
Dpysl2	T	C	14: 67,052,926 (GRCm39)	S308G	probably damaging	Het
Dusp22	A	T	13: 30,892,726 (GRCm39)	I168F	probably benign	Het
Ecel1	A	G	1: 87,079,872 (GRCm39)	S414P	probably damaging	Het
Fat2	A	G	11: 55,174,810 (GRCm39)	F1968L	probably damaging	Het
Fsip2	C	T	2: 82,805,493 (GRCm39)	T604I	probably damaging	Het
H2-DMb1	T	A	17: 34,374,547 (GRCm39)	F66I	possibly damaging	Het
Hgf	T	C	5: 16,819,991 (GRCm39)	V574A	probably damaging	Het
Hoxa7	A	T	6: 52,193,605 (GRCm39)	Y137*	probably null	Het
Ikbke	T	A	1: 131,191,085 (GRCm39)	I519F	probably damaging	Het
Inpp5j	T	G	11: 3,451,107 (GRCm39)	H514P	probably damaging	Het
Kmt2d	A	G	15: 98,738,070 (GRCm39)		probably benign	Het
Larp7	T	A	3: 127,340,603 (GRCm39)	R112S	probably benign	Het
Lepr	C	T	4: 101,590,611 (GRCm39)	A63V	probably benign	Het
Lmx1a	G	T	1: 167,660,428 (GRCm39)	V238L	probably damaging	Het
Man1c1	G	C	4: 134,430,749 (GRCm39)	P11R	probably damaging	Het
Mcmbp	T	C	7: 128,317,729 (GRCm39)	E172G	possibly damaging	Het
Mcpt8	G	A	14: 56,321,375 (GRCm39)	H30Y	probably damaging	Het
Nek8	C	A	11: 78,061,309 (GRCm39)	V379L	probably benign	Het
Numa1	T	G	7: 101,658,945 (GRCm39)	L356R	probably damaging	Het
Pard6b	C	T	2: 167,940,943 (GRCm39)	A310V	probably benign	Het
Pcgf5	C	A	19: 36,414,740 (GRCm39)	N26K	possibly damaging	Het
Phtf1	G	A	3: 103,910,919 (GRCm39)		probably null	Het
Plch1	C	A	3: 63,618,640 (GRCm39)	D675Y	probably damaging	Het
Plk2	A	G	13: 110,532,871 (GRCm39)	H144R	probably damaging	Het
Rax	T	A	18: 66,068,152 (GRCm39)	N318Y	unknown	Het
Slc9a5	A	G	8: 106,085,103 (GRCm39)	N535D	possibly damaging	Het
Smarcd2	T	A	11: 106,157,731 (GRCm39)	K138*	probably null	Het
Taar7e	A	T	10: 23,913,932 (GRCm39)	I141F	probably damaging	Het
Taar7f	T	A	10: 23,925,921 (GRCm39)	W172R	probably damaging	Het
Tango6	A	G	8: 107,415,856 (GRCm39)	I226V	probably benign	Het
Tcn2	T	C	11: 3,872,114 (GRCm39)	K338E	possibly damaging	Het
Tdp1	C	A	12: 99,864,588 (GRCm39)	A243E	probably damaging	Het
Tfpt	A	G	7: 3,623,386 (GRCm39)	Y240H	probably damaging	Het
Tmod4	A	G	3: 95,035,140 (GRCm39)	D215G	probably benign	Het
Urgcp	C	A	11: 5,665,878 (GRCm39)	G820V	probably damaging	Het
Zfand2b	A	T	1: 75,146,454 (GRCm39)	M110L	probably benign	Het
Zfyve1	A	T	12: 83,621,909 (GRCm39)	V162E	probably damaging	Het

Other mutations in Top3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Top3b	APN	16	16,705,486 (GRCm39)	missense	probably damaging	0.97
IGL01512:Top3b	APN	16	16,709,286 (GRCm39)	missense	possibly damaging	0.74
IGL01552:Top3b	APN	16	16,705,687 (GRCm39)	splice site	probably benign
IGL01738:Top3b	APN	16	16,698,468 (GRCm39)	missense	probably benign	0.04
IGL02090:Top3b	APN	16	16,709,334 (GRCm39)	missense	possibly damaging	0.81
R0143:Top3b	UTSW	16	16,701,389 (GRCm39)	missense	probably damaging	0.97
R0883:Top3b	UTSW	16	16,697,301 (GRCm39)	splice site	probably benign
R1386:Top3b	UTSW	16	16,698,493 (GRCm39)	missense	probably benign	0.29
R1440:Top3b	UTSW	16	16,710,641 (GRCm39)	nonsense	probably null
R1958:Top3b	UTSW	16	16,702,166 (GRCm39)	missense	possibly damaging	0.52
R1970:Top3b	UTSW	16	16,701,383 (GRCm39)	missense	probably damaging	1.00
R4292:Top3b	UTSW	16	16,701,383 (GRCm39)	missense	probably damaging	1.00
R4307:Top3b	UTSW	16	16,707,481 (GRCm39)	splice site	probably benign
R4832:Top3b	UTSW	16	16,708,526 (GRCm39)	nonsense	probably null
R5047:Top3b	UTSW	16	16,709,282 (GRCm39)	missense	probably benign	0.00
R5364:Top3b	UTSW	16	16,704,834 (GRCm39)	missense	probably benign	0.00
R5590:Top3b	UTSW	16	16,709,441 (GRCm39)	intron	probably benign
R5604:Top3b	UTSW	16	16,707,399 (GRCm39)	nonsense	probably null
R5719:Top3b	UTSW	16	16,703,700 (GRCm39)	missense	probably damaging	1.00
R5969:Top3b	UTSW	16	16,701,429 (GRCm39)	critical splice donor site	probably null
R6018:Top3b	UTSW	16	16,710,756 (GRCm39)	missense	probably damaging	1.00
R6144:Top3b	UTSW	16	16,697,005 (GRCm39)	splice site	probably null
R6155:Top3b	UTSW	16	16,709,373 (GRCm39)	missense	probably damaging	1.00
R6341:Top3b	UTSW	16	16,696,935 (GRCm39)	missense	probably damaging	0.98
R6700:Top3b	UTSW	16	16,710,533 (GRCm39)	missense	possibly damaging	0.48
R7417:Top3b	UTSW	16	16,695,714 (GRCm39)	start gained	probably benign
R7586:Top3b	UTSW	16	16,709,232 (GRCm39)	missense	probably benign	0.44
R7747:Top3b	UTSW	16	16,705,585 (GRCm39)	missense	probably benign	0.17
R8382:Top3b	UTSW	16	16,705,867 (GRCm39)	missense	probably damaging	1.00
R8438:Top3b	UTSW	16	16,709,364 (GRCm39)	missense	probably benign	0.04
R9142:Top3b	UTSW	16	16,701,299 (GRCm39)	missense	probably damaging	1.00
R9311:Top3b	UTSW	16	16,700,563 (GRCm39)	critical splice donor site	probably null
R9630:Top3b	UTSW	16	16,710,354 (GRCm39)	missense	probably benign	0.03
X0011:Top3b	UTSW	16	16,708,053 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCATATCTGGAAGGGAGTGC -3'
(R):5'- GAACAGCACCTAGTGAATGCAC -3'

Sequencing Primer
(F):5'- ACCCAGGTTGCAAGGGATTTC -3'
(R):5'- TGAATGCACAGCCGATGC -3'

Posted On

2015-06-10