Incidental Mutation 'R4212:Slc2a12'
ID319253
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission 041641-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22702094 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 596 (K596N)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261] [ENSMUST00000095794] [ENSMUST00000127698]
Predicted Effect probably benign
Transcript: ENSMUST00000042261
AA Change: K596N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: K596N

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095794
SMART Domains Protein: ENSMUSP00000093470
Gene: ENSMUSG00000071359

DomainStartEndE-ValueType
Pfam:TBP 8 92 8.3e-24 PFAM
Pfam:TBP 97 182 4.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127698
SMART Domains Protein: ENSMUSP00000114223
Gene: ENSMUSG00000071359

DomainStartEndE-ValueType
Pfam:TBP 10 91 2.4e-25 PFAM
Pfam:TBP 99 181 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141569
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Scn8a T C 15: 100,957,073 V147A possibly damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6385:Slc2a12 UTSW 10 22694030 missense possibly damaging 0.69
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAGCACATTAAGGCTTCACAG -3'
(R):5'- TCAGGACATTGGTGCCTCTTG -3'

Sequencing Primer
(F):5'- GGCTTCACAGTAAAAACGTTTTTCC -3'
(R):5'- GCCTCTTGTACCTTTTGGCAAAAG -3'
Posted On2015-06-10