Incidental Mutation 'R4212:Scn8a'
ID319275
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Namesodium channel, voltage-gated, type VIII, alpha
Synonymsmnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
MMRRC Submission 041641-MU
Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R4212 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location100869858-101045938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100957073 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 147 (V147A)
Ref Sequence ENSEMBL: ENSMUSP00000144013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201518] [ENSMUST00000201549] [ENSMUST00000202702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082209
AA Change: V147A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: V147A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108908
AA Change: V147A

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: V147A

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000108909
AA Change: V147A
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: V147A

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108910
AA Change: V147A

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: V147A

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200963
AA Change: V147A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: V147A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201438
AA Change: V24A
Predicted Effect probably benign
Transcript: ENSMUST00000201518
AA Change: V147A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143879
Gene: ENSMUSG00000023033
AA Change: V147A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 8.8e-81 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 6.7e-70 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 804 5.3e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000201549
AA Change: V147A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: V147A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202349
Predicted Effect probably benign
Transcript: ENSMUST00000202702
SMART Domains Protein: ENSMUSP00000143876
Gene: ENSMUSG00000023033

DomainStartEndE-ValueType
Pfam:Ion_trans 1 272 7.9e-75 PFAM
low complexity region 273 302 N/A INTRINSIC
Pfam:Na_trans_cytopl 349 539 9.4e-67 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,381,991 G269E probably damaging Het
A1bg G T 15: 60,919,736 L284M possibly damaging Het
Adamts15 A G 9: 30,906,174 V536A probably damaging Het
AI464131 T C 4: 41,498,307 E441G probably benign Het
Arsi A T 18: 60,916,701 I219F probably damaging Het
Atg7 G A 6: 114,703,425 G447E probably benign Het
Bdp1 T A 13: 100,059,585 H1223L probably benign Het
Cep152 A G 2: 125,620,001 M87T probably benign Het
Chrm3 T C 13: 9,877,755 D415G probably benign Het
Chrnb2 A T 3: 89,761,544 C155S probably damaging Het
Col6a4 T A 9: 106,075,370 Q443L probably benign Het
D5Ertd579e A T 5: 36,614,479 D857E probably damaging Het
Efcab6 T C 15: 83,892,863 D1124G probably damaging Het
F830045P16Rik C T 2: 129,460,353 A440T probably benign Het
Gc T C 5: 89,435,575 K370E probably benign Het
Gm11559 A G 11: 99,864,900 Q125R unknown Het
Gm3985 A T 8: 32,942,456 noncoding transcript Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gm8765 C T 13: 50,700,352 T82I possibly damaging Het
Gucy2e A G 11: 69,228,123 F681S probably damaging Het
Hip1r A G 5: 123,999,890 I760V probably benign Het
Islr2 C T 9: 58,199,320 G219D probably damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Jag1 T C 2: 137,085,070 D923G probably benign Het
Kmt2c A G 5: 25,347,359 probably null Het
Kmt2d A G 15: 98,845,003 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Lats2 C T 14: 57,696,255 D802N possibly damaging Het
Lrfn5 A T 12: 61,843,820 T632S probably benign Het
Myo9a C T 9: 59,906,066 R2183* probably null Het
Naip1 T C 13: 100,426,875 probably null Het
Nf1 T A 11: 79,469,798 V1434E probably damaging Het
Nlrc4 T C 17: 74,447,115 Y91C possibly damaging Het
Olfr1454 T G 19: 13,063,759 M116R probably damaging Het
Olfr173 T A 16: 58,797,369 H159L possibly damaging Het
Olfr723 A T 14: 49,928,889 Y218* probably null Het
Pard3 T A 8: 127,610,458 I1143K probably benign Het
Pcdha7 A G 18: 36,974,974 T351A probably benign Het
Phf2 C A 13: 48,820,613 G318V unknown Het
Plch1 T A 3: 63,870,759 probably benign Het
Polr1c A G 17: 46,246,120 I79T probably damaging Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Psmd12 T C 11: 107,485,759 C74R probably damaging Het
Ralgapa1 A G 12: 55,739,330 probably null Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Sema3b C T 9: 107,603,398 V117M probably damaging Het
Sfxn5 A T 6: 85,332,306 L139* probably null Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tshz3 A G 7: 36,770,119 D511G probably damaging Het
Usp44 A G 10: 93,846,770 K314E possibly damaging Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
nymph UTSW 15 101035646 missense probably damaging 1.00
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100957489 missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 101029692 missense probably damaging 0.98
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0254:Scn8a UTSW 15 101018364 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0538:Scn8a UTSW 15 101035624 nonsense probably null
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0631:Scn8a UTSW 15 101035537 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1669:Scn8a UTSW 15 101011120 missense probably damaging 1.00
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1735:Scn8a UTSW 15 101015861 missense possibly damaging 0.94
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2516:Scn8a UTSW 15 100969162 missense probably benign 0.05
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 unclassified probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 intron probably null
R7108:Scn8a UTSW 15 101039778 missense probably benign 0.01
R7215:Scn8a UTSW 15 101029830 missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100970227 missense probably benign 0.00
R7219:Scn8a UTSW 15 100969103 missense probably damaging 1.00
R7356:Scn8a UTSW 15 100957579 missense probably damaging 1.00
R7479:Scn8a UTSW 15 100955477 missense probably damaging 0.99
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCAGTCAGATGGGATGTCC -3'
(R):5'- ATTCACGTCTAATGCTGTTCCCTAG -3'

Sequencing Primer
(F):5'- GGATGTCCAGGGCTTTCC -3'
(R):5'- AATGCTGTTCCCTAGATTCCACG -3'
Posted On2015-06-10