Incidental Mutation 'R4214:Fez1'
ID319349
Institutional Source Beutler Lab
Gene Symbol Fez1
Ensembl Gene ENSMUSG00000032118
Gene Namefasciculation and elongation protein zeta 1 (zygin I)
SynonymsUNC-76, UNC76
MMRRC Submission 041041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4214 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location36821864-36878924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36870488 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 20 (N20S)
Ref Sequence ENSEMBL: ENSMUSP00000124185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034630] [ENSMUST00000162235] [ENSMUST00000163816]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034630
AA Change: N343S

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034630
Gene: ENSMUSG00000032118
AA Change: N343S

DomainStartEndE-ValueType
Pfam:FEZ 58 300 3.4e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159137
Predicted Effect probably benign
Transcript: ENSMUST00000160041
SMART Domains Protein: ENSMUSP00000124648
Gene: ENSMUSG00000032118

DomainStartEndE-ValueType
Pfam:FEZ 35 87 4.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161978
Predicted Effect probably damaging
Transcript: ENSMUST00000162235
AA Change: N20S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000163816
AA Change: N343S

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126072
Gene: ENSMUSG00000032118
AA Change: N343S

DomainStartEndE-ValueType
Pfam:FEZ 58 297 2.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216539
Meta Mutation Damage Score 0.35 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.5%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity and increased sensitivity to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik C T 1: 192,833,537 noncoding transcript Het
Abca12 T A 1: 71,288,697 D1408V probably damaging Het
Abca13 A T 11: 9,293,877 L1913F probably damaging Het
Acad9 A G 3: 36,073,603 E118G probably damaging Het
Adamts5 G A 16: 85,868,643 A590V probably damaging Het
Ano6 A C 15: 95,965,909 Y791S probably benign Het
Aox2 T C 1: 58,307,444 probably null Het
Aox4 T A 1: 58,221,892 I128N probably damaging Het
Atp2b3 A G X: 73,570,315 M1142V probably benign Het
AU041133 A G 10: 82,151,389 H292R probably damaging Het
Bco2 A G 9: 50,545,366 M158T probably benign Het
Bpnt1 T A 1: 185,345,429 probably benign Het
Cadm1 A G 9: 47,797,443 D157G probably damaging Het
Catsperg1 T C 7: 29,195,932 R499G possibly damaging Het
Ccr7 T C 11: 99,145,046 E350G probably damaging Het
Ceacam5 T A 7: 17,752,151 S524R probably benign Het
Cep78 T C 19: 15,959,579 T588A probably benign Het
Cfap65 T A 1: 74,927,681 E282D possibly damaging Het
Drd2 A G 9: 49,404,921 K327R probably benign Het
Erich5 C T 15: 34,471,411 P262L possibly damaging Het
Ezh2 A C 6: 47,533,814 D578E probably damaging Het
Folr2 T G 7: 101,843,699 K39T probably damaging Het
Gm10549 G T 18: 33,464,477 probably null Het
Gm14393 C T 2: 175,061,847 C89Y probably benign Het
Gm5329 T G 7: 31,972,403 noncoding transcript Het
Gm7367 A G 7: 60,155,769 noncoding transcript Het
Gpr162 A T 6: 124,860,068 W338R probably damaging Het
Ift80 A T 3: 68,990,808 F65I possibly damaging Het
Klra6 T G 6: 130,018,922 I158L probably benign Het
Lpp T A 16: 24,762,054 Y173* probably null Het
Lrp12 A G 15: 39,872,580 V671A probably benign Het
Lrrc27 C T 7: 139,223,693 R178C probably damaging Het
Lrrc49 G A 9: 60,666,326 T225M probably benign Het
Megf8 T A 7: 25,355,368 S1915T probably benign Het
Mmadhc T C 2: 50,291,332 T109A probably benign Het
Mon2 T C 10: 123,016,492 E992G probably benign Het
Msl3 A T X: 168,662,434 N430K probably damaging Het
Msl3 A G X: 168,667,063 I267T probably damaging Het
Nab2 G T 10: 127,665,048 Y25* probably null Het
Notch3 T C 17: 32,132,207 E1938G possibly damaging Het
Olfr291 C T 7: 84,857,289 H307Y probably benign Het
Osgepl1 A G 1: 53,315,008 T44A probably damaging Het
Pdpr A G 8: 111,129,580 probably benign Het
Pfkp A G 13: 6,619,225 S241P probably damaging Het
Phgdh A T 3: 98,328,061 S166T possibly damaging Het
Plcl1 C T 1: 55,751,335 Q1055* probably null Het
Plscr2 A G 9: 92,287,737 N80S probably benign Het
Polr3k A T 2: 181,868,242 M80L probably benign Het
Prex2 A G 1: 11,101,159 D304G probably damaging Het
Prex2 A G 1: 11,285,061 T1529A probably damaging Het
Rcvrn A T 11: 67,695,688 H91L possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Tbx18 T C 9: 87,724,465 Y209C probably damaging Het
Themis3 T C 17: 66,560,017 N76S probably benign Het
Trhde A T 10: 114,788,070 S310T possibly damaging Het
Vmn1r213 G A 13: 23,012,003 C252Y possibly damaging Het
Zfp523 T C 17: 28,201,029 V216A probably benign Het
Other mutations in Fez1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Fez1 APN 9 36850399 missense probably damaging 0.97
R1280:Fez1 UTSW 9 36870549 frame shift probably null
R1458:Fez1 UTSW 9 36870549 frame shift probably null
R1741:Fez1 UTSW 9 36843733 missense probably damaging 1.00
R1846:Fez1 UTSW 9 36867767 missense probably damaging 1.00
R2072:Fez1 UTSW 9 36867945 missense probably benign 0.00
R4193:Fez1 UTSW 9 36843727 missense probably damaging 1.00
R4417:Fez1 UTSW 9 36870472 splice site probably benign
R4696:Fez1 UTSW 9 36870470 splice site probably null
R4735:Fez1 UTSW 9 36860845 nonsense probably null
R4947:Fez1 UTSW 9 36868875 missense probably damaging 0.99
R4950:Fez1 UTSW 9 36867882 missense probably damaging 1.00
R5538:Fez1 UTSW 9 36868876 missense probably damaging 1.00
R5618:Fez1 UTSW 9 36843932 missense probably damaging 1.00
R5742:Fez1 UTSW 9 36850447 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCCATTGATACAGGAAAGCTTAC -3'
(R):5'- TGCAGAAATTCTTGCCCCATG -3'

Sequencing Primer
(F):5'- TGATACAGGAAAGCTTACTTTTGAG -3'
(R):5'- GCCATCCTAAAGAAATCTGGAAACTG -3'
Posted On2015-06-10