Incidental Mutation 'R0395:Apba2'
ID31940
Institutional Source Beutler Lab
Gene Symbol Apba2
Ensembl Gene ENSMUSG00000030519
Gene Nameamyloid beta (A4) precursor protein-binding, family A, member 2
SynonymsX11L, X11-like, Mint 2
MMRRC Submission 038601-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R0395 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64501706-64753878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64743408 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 547 (I547N)
Ref Sequence ENSEMBL: ENSMUSP00000146038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246]
Predicted Effect probably benign
Transcript: ENSMUST00000032732
AA Change: I559N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: I559N

DomainStartEndE-ValueType
low complexity region 82 96 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
PTB 368 534 6.31e-29 SMART
PDZ 578 656 6.32e-12 SMART
PDZ 670 736 1.79e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206061
Predicted Effect probably benign
Transcript: ENSMUST00000206246
AA Change: I547N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000206630
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,689,656 K205R possibly damaging Het
9630041A04Rik A T 9: 101,942,735 N118I probably damaging Het
Acsm2 G A 7: 119,575,746 D245N probably damaging Het
Adgrv1 A T 13: 81,385,953 H5836Q probably benign Het
Ahcyl2 T C 6: 29,886,168 V391A probably damaging Het
Alcam A T 16: 52,309,864 M41K probably benign Het
Aldh3b3 A C 19: 3,966,472 E363D probably benign Het
Alk A G 17: 72,603,531 V60A probably damaging Het
Als2cl G A 9: 110,898,084 R906H probably damaging Het
Ap5z1 T C 5: 142,470,562 probably benign Het
Apol10b A T 15: 77,585,640 D112E probably damaging Het
Ash1l C A 3: 89,058,589 R2433S probably damaging Het
Cachd1 T C 4: 100,953,205 F335L probably damaging Het
Cbfa2t3 G T 8: 122,638,951 Q181K probably benign Het
Cct6b A G 11: 82,739,680 M265T probably benign Het
Cd151 G A 7: 141,470,391 V180I probably damaging Het
Ces1h T A 8: 93,357,078 N412I unknown Het
Chmp7 T C 14: 69,732,456 T12A probably benign Het
Clasp1 A G 1: 118,539,331 T534A possibly damaging Het
Cldn15 T A 5: 136,968,198 V31E possibly damaging Het
Col16a1 G A 4: 130,073,109 G583D probably damaging Het
Csmd1 T C 8: 16,346,638 N426S probably damaging Het
Dapp1 C T 3: 137,935,637 C199Y possibly damaging Het
Dchs1 A G 7: 105,758,538 L2029P probably damaging Het
Diexf T C 1: 193,123,676 E187G possibly damaging Het
Dmc1 A G 15: 79,588,772 F158S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Dthd1 T A 5: 62,814,333 N166K possibly damaging Het
Enam A T 5: 88,501,508 Y292F probably damaging Het
Esrrg A T 1: 188,198,635 I285F probably damaging Het
Fam19a2 A T 10: 123,593,592 H37L probably benign Het
Fam50b A G 13: 34,747,237 D232G probably damaging Het
Fam91a1 T A 15: 58,454,792 S792T probably benign Het
Fbxw22 A C 9: 109,381,685 C419W probably damaging Het
Flt4 G A 11: 49,630,343 S393N probably benign Het
Fras1 A T 5: 96,769,653 T3511S possibly damaging Het
Frat2 A C 19: 41,847,824 S30A probably damaging Het
Glp1r T A 17: 30,936,338 M433K probably benign Het
Gm10300 G A 4: 132,074,988 probably benign Het
Gm13178 A G 4: 144,703,195 V408A probably benign Het
Gm684 C T 9: 51,280,534 probably benign Het
Gpatch4 A G 3: 88,054,354 probably benign Het
Gpr22 A T 12: 31,709,462 S220R possibly damaging Het
Grn T C 11: 102,436,223 V549A probably benign Het
Gtf3c5 T C 2: 28,577,918 D177G probably damaging Het
Htr1b A T 9: 81,631,651 M301K probably benign Het
Ifi207 A T 1: 173,729,865 S436T possibly damaging Het
Ifnb1 A T 4: 88,522,529 N82K possibly damaging Het
Ina T G 19: 47,021,919 N384K probably damaging Het
Kirrel2 T C 7: 30,450,458 N541D possibly damaging Het
Lrp2 A T 2: 69,433,077 I4377N possibly damaging Het
Lrrc37a A G 11: 103,464,395 V2532A unknown Het
Mast4 T C 13: 102,735,273 E2529G probably damaging Het
Myh6 T C 14: 54,946,320 H1719R possibly damaging Het
Myo5a A T 9: 75,193,977 H150L probably benign Het
Naglu C T 11: 101,074,107 probably benign Het
Nags G A 11: 102,145,704 A40T unknown Het
Nav1 G T 1: 135,532,621 Y321* probably null Het
Nav1 A T 1: 135,532,623 Y321N probably damaging Het
Neu3 C T 7: 99,813,778 S246N probably benign Het
Npy5r C T 8: 66,681,973 G56D probably benign Het
Nrxn1 A G 17: 91,088,314 V138A possibly damaging Het
Nuggc C T 14: 65,613,472 Q264* probably null Het
Ogfod1 G A 8: 94,063,528 probably null Het
Olfr108 T A 17: 37,445,866 F115Y probably damaging Het
Olfr1453 A G 19: 13,028,299 F10S probably damaging Het
Olfr315 A T 11: 58,778,369 M81L probably benign Het
Olfr490 A G 7: 108,286,271 V285A probably benign Het
Per1 T A 11: 69,102,277 I340N probably damaging Het
Pkhd1 C T 1: 20,381,547 A2175T probably benign Het
Pogk A G 1: 166,403,602 V52A probably damaging Het
Ppib A T 9: 66,066,319 T185S possibly damaging Het
Ptar1 G T 19: 23,720,199 M358I probably damaging Het
Qser1 A C 2: 104,762,881 I1597S probably damaging Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Repin1 C A 6: 48,597,525 R460S probably damaging Het
Sfmbt1 T C 14: 30,787,617 probably benign Het
Sh3rf1 C T 8: 61,393,662 probably benign Het
Shroom3 C T 5: 92,780,903 R106C probably damaging Het
Siglecf T A 7: 43,355,975 V453D probably damaging Het
Slc2a9 A G 5: 38,453,169 S96P probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Slf1 A G 13: 77,105,969 probably benign Het
Smad1 T G 8: 79,349,782 K269T probably benign Het
Srp54b G A 12: 55,250,099 R194H probably damaging Het
St8sia6 T A 2: 13,665,436 S238C probably damaging Het
Stat3 A T 11: 100,889,937 probably benign Het
Tas1r2 T A 4: 139,655,354 M101K possibly damaging Het
Tesc A G 5: 118,053,582 probably null Het
Tle3 T A 9: 61,410,071 M334K probably damaging Het
Tmem151a A T 19: 5,082,233 V315E probably damaging Het
Tmprss2 T C 16: 97,567,045 D480G probably damaging Het
Trmt1 C A 8: 84,697,112 probably null Het
Tsr3 T C 17: 25,242,224 probably null Het
Ube2u A G 4: 100,481,648 K37E probably benign Het
Usp16 T A 16: 87,475,446 D382E probably damaging Het
Usp9y A T Y: 1,340,053 F1442Y probably damaging Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
V1ra8 C T 6: 90,203,009 L65F possibly damaging Het
Vmn2r10 T C 5: 109,001,993 N395S probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp330 G A 8: 82,764,882 Q221* probably null Het
Other mutations in Apba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Apba2 APN 7 64736941 missense possibly damaging 0.79
IGL01716:Apba2 APN 7 64745826 splice site probably benign
IGL02218:Apba2 APN 7 64695677 missense probably benign 0.01
IGL02343:Apba2 APN 7 64695146 missense probably damaging 0.96
IGL03265:Apba2 APN 7 64695323 missense probably damaging 1.00
guadalupe UTSW 7 64750164 missense probably damaging 1.00
LCD18:Apba2 UTSW 7 64622160 intron probably benign
R0554:Apba2 UTSW 7 64745780 missense probably damaging 1.00
R0624:Apba2 UTSW 7 64714515 splice site probably null
R0733:Apba2 UTSW 7 64750164 missense probably damaging 1.00
R1107:Apba2 UTSW 7 64745719 missense possibly damaging 0.51
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1486:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R1895:Apba2 UTSW 7 64744630 critical splice donor site probably null
R1942:Apba2 UTSW 7 64695470 missense possibly damaging 0.92
R1946:Apba2 UTSW 7 64744630 critical splice donor site probably null
R2002:Apba2 UTSW 7 64733542 missense probably damaging 0.97
R2089:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2571:Apba2 UTSW 7 64745750 missense probably damaging 0.98
R3035:Apba2 UTSW 7 64739792 missense probably benign 0.03
R4620:Apba2 UTSW 7 64714467 missense probably damaging 1.00
R5468:Apba2 UTSW 7 64745762 missense probably damaging 1.00
R5478:Apba2 UTSW 7 64695186 nonsense probably null
R5644:Apba2 UTSW 7 64715511 missense probably benign
R5645:Apba2 UTSW 7 64695806 missense possibly damaging 0.92
R5941:Apba2 UTSW 7 64745716 missense probably benign 0.03
R5969:Apba2 UTSW 7 64744447 nonsense probably null
R6190:Apba2 UTSW 7 64739880 missense probably damaging 0.98
R6806:Apba2 UTSW 7 64695459 missense probably damaging 1.00
R7098:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R7143:Apba2 UTSW 7 64744417 missense probably damaging 1.00
R7183:Apba2 UTSW 7 64733545 missense probably benign 0.11
R7260:Apba2 UTSW 7 64739745 missense probably damaging 1.00
R7479:Apba2 UTSW 7 64739859 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TTTATGGACCCCTAGTGGAGCCTG -3'
(R):5'- GAGGAAGGAAGCCTTGCTCTCATC -3'

Sequencing Primer
(F):5'- CCTAGTGGAGCCTGTGTCC -3'
(R):5'- TCATCTTTGCCTGGTGAGC -3'
Posted On2013-04-24