Incidental Mutation 'R4222:Ston1'
ID319423
Institutional Source Beutler Lab
Gene Symbol Ston1
Ensembl Gene ENSMUSG00000033855
Gene Namestonin 1
Synonyms
MMRRC Submission 041042-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R4222 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location88597684-88662586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88636771 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 535 (Y535C)
Ref Sequence ENSEMBL: ENSMUSP00000131703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000137138] [ENSMUST00000150023] [ENSMUST00000163588]
Predicted Effect probably damaging
Transcript: ENSMUST00000064035
AA Change: Y535C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: Y535C

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132384
Predicted Effect probably benign
Transcript: ENSMUST00000137138
SMART Domains Protein: ENSMUSP00000118522
Gene: ENSMUSG00000033855

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150023
AA Change: Y535C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: Y535C

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153613
Predicted Effect probably damaging
Transcript: ENSMUST00000163588
AA Change: Y535C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: Y535C

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 711 2.1e-64 PFAM
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,718,749 S1115T probably benign Het
Adgre4 A G 17: 55,785,121 Y127C probably damaging Het
AF366264 T C 8: 13,838,061 E10G probably benign Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Alkal1 A G 1: 6,388,615 K76R probably damaging Het
Atm T C 9: 53,480,669 S1807G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
Cyp3a11 A T 5: 145,860,466 Y368N probably damaging Het
Gar1 A T 3: 129,830,806 probably benign Het
Gm5265 A T 1: 169,453,801 noncoding transcript Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Hapln4 T A 8: 70,086,960 W214R probably damaging Het
Hist1h1b A T 13: 21,779,977 probably benign Het
Irgq C A 7: 24,533,625 A297D possibly damaging Het
Kri1 T C 9: 21,281,063 E145G probably benign Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mrpl22 T A 11: 58,171,867 probably benign Het
Myo7a T A 7: 98,073,229 Q1163L possibly damaging Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Nrxn3 G T 12: 89,532,992 G718* probably null Het
Olfm3 C T 3: 115,090,171 Q41* probably null Het
Olfr52 G T 2: 86,181,997 T38K probably damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Parm1 G A 5: 91,593,867 M31I probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Pkn2 A T 3: 142,793,866 L950* probably null Het
Plec C T 15: 76,177,319 R2671H probably damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Ptk7 A T 17: 46,574,463 M679K probably benign Het
Ptx3 C T 3: 66,224,706 T216I probably damaging Het
Rrp8 T C 7: 105,734,022 I346V possibly damaging Het
Rsrc1 A G 3: 66,994,567 K17E unknown Het
Ryr2 T A 13: 11,737,873 E1854V possibly damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Spag5 G A 11: 78,304,511 V215I probably damaging Het
Tbc1d14 A T 5: 36,493,108 S395T probably benign Het
Tlr11 C T 14: 50,361,849 P431S probably damaging Het
Trerf1 G T 17: 47,314,801 noncoding transcript Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Ttc26 A G 6: 38,395,075 Y200C probably damaging Het
Vmn1r49 A G 6: 90,072,246 F258S probably benign Het
Vmn1r-ps103 C A 13: 22,442,028 noncoding transcript Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Zbtb5 A G 4: 44,993,855 probably null Het
Zfp35 T G 18: 24,003,189 F197V possibly damaging Het
Other mutations in Ston1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ston1 APN 17 88644443 missense probably benign 0.00
IGL01593:Ston1 APN 17 88637010 missense probably null 1.00
FR4449:Ston1 UTSW 17 88635525 missense probably benign 0.38
R0610:Ston1 UTSW 17 88635281 missense possibly damaging 0.49
R1421:Ston1 UTSW 17 88635793 missense probably benign 0.02
R1620:Ston1 UTSW 17 88635816 missense probably benign 0.01
R2002:Ston1 UTSW 17 88635529 missense probably benign 0.01
R3108:Ston1 UTSW 17 88636155 nonsense probably null
R3766:Ston1 UTSW 17 88635360 missense probably damaging 1.00
R4335:Ston1 UTSW 17 88635697 missense probably damaging 1.00
R4355:Ston1 UTSW 17 88637008 missense probably damaging 1.00
R4867:Ston1 UTSW 17 88635694 missense probably damaging 1.00
R4902:Ston1 UTSW 17 88645252 missense probably damaging 0.99
R5084:Ston1 UTSW 17 88636574 missense probably benign 0.00
R5434:Ston1 UTSW 17 88645311 utr 3 prime probably benign
R5700:Ston1 UTSW 17 88644339 missense probably damaging 1.00
R5858:Ston1 UTSW 17 88635631 missense possibly damaging 0.93
R5863:Ston1 UTSW 17 88635945 missense possibly damaging 0.64
R6458:Ston1 UTSW 17 88635303 missense probably benign 0.14
R6459:Ston1 UTSW 17 88636468 missense probably benign 0.16
R7012:Ston1 UTSW 17 88635985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGATTGCTATTCTTGACTACC -3'
(R):5'- GGTTCAGATTCAGGCTCCTG -3'

Sequencing Primer
(F):5'- CTACCATTTCCATACGTGTGTGAAGG -3'
(R):5'- GGTTCAGATTCAGGCTCCTGTAAAC -3'
Posted On2015-06-10