Incidental Mutation 'R4223:Lrrc55'
ID319436
Institutional Source Beutler Lab
Gene Symbol Lrrc55
Ensembl Gene ENSMUSG00000075224
Gene Nameleucine rich repeat containing 55
SynonymsLOC241528, A330097E02Rik
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85162334-85196699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85196116 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 188 (A188V)
Ref Sequence ENSEMBL: ENSMUSP00000107228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099930] [ENSMUST00000111601]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099930
AA Change: A188V

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097514
Gene: ENSMUSG00000075224
AA Change: A188V

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
LRRNT 50 82 2.57e-7 SMART
LRR 103 124 3.29e-1 SMART
LRR 126 148 4.7e0 SMART
LRR 150 173 2.47e2 SMART
LRR 174 197 2.4e1 SMART
LRRCT 209 263 6.85e-9 SMART
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111601
AA Change: A188V

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107228
Gene: ENSMUSG00000075224
AA Change: A188V

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
LRRNT 50 82 2.57e-7 SMART
LRR 103 124 3.29e-1 SMART
LRR 126 148 4.7e0 SMART
LRR 150 173 2.47e2 SMART
LRR 174 197 2.4e1 SMART
LRRCT 209 263 6.85e-9 SMART
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139377
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Lrrc55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Lrrc55 APN 2 85196215 missense possibly damaging 0.53
IGL01646:Lrrc55 APN 2 85191989 missense probably damaging 0.99
R0149:Lrrc55 UTSW 2 85196245 missense probably damaging 0.98
R0361:Lrrc55 UTSW 2 85196245 missense probably damaging 0.98
R0491:Lrrc55 UTSW 2 85191920 missense probably damaging 1.00
R4654:Lrrc55 UTSW 2 85196536 missense possibly damaging 0.82
R4746:Lrrc55 UTSW 2 85196170 missense probably damaging 1.00
R5756:Lrrc55 UTSW 2 85196383 missense probably benign 0.34
R6329:Lrrc55 UTSW 2 85196309 missense probably benign 0.28
R6705:Lrrc55 UTSW 2 85196355 missense probably benign 0.33
R6985:Lrrc55 UTSW 2 85191930 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAACCTTCTGCCTGGTGAC -3'
(R):5'- TGCGAAACAACTCCTTGATGG -3'

Sequencing Primer
(F):5'- GGTGACCTGTCCAGTCATC -3'
(R):5'- GCTTAGCACACCTGGATCTAAG -3'
Posted On2015-06-10