Incidental Mutation 'R4223:Olfr1288'
ID319437
Institutional Source Beutler Lab
Gene Symbol Olfr1288
Ensembl Gene ENSMUSG00000044039
Gene Nameolfactory receptor 1288
SynonymsMOR245-9, GA_x6K02T2Q125-72530279-72531217
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111474101-111479994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111479144 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 120 (Y120F)
Ref Sequence ENSEMBL: ENSMUSP00000150331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104889] [ENSMUST00000120021] [ENSMUST00000207494] [ENSMUST00000214816]
Predicted Effect probably benign
Transcript: ENSMUST00000104889
AA Change: Y120F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000100485
Gene: ENSMUSG00000044039
AA Change: Y120F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-43 PFAM
Pfam:7tm_1 41 287 2.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120021
Predicted Effect probably benign
Transcript: ENSMUST00000207494
Predicted Effect probably benign
Transcript: ENSMUST00000214816
AA Change: Y120F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225425
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Olfr1288
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Olfr1288 APN 2 111478864 missense probably benign
IGL02021:Olfr1288 APN 2 111479480 missense probably benign 0.03
IGL02061:Olfr1288 APN 2 111479269 missense possibly damaging 0.94
R2016:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2017:Olfr1288 UTSW 2 111479187 missense probably benign 0.00
R2848:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R2849:Olfr1288 UTSW 2 111479354 missense probably benign 0.00
R3421:Olfr1288 UTSW 2 111478952 missense probably benign 0.12
R4432:Olfr1288 UTSW 2 111479412 nonsense probably null
R4433:Olfr1288 UTSW 2 111479412 nonsense probably null
R4476:Olfr1288 UTSW 2 111479664 missense possibly damaging 0.58
R4631:Olfr1288 UTSW 2 111479563 missense probably damaging 1.00
R6029:Olfr1288 UTSW 2 111478965 nonsense probably null
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6036:Olfr1288 UTSW 2 111478988 missense probably damaging 1.00
R6084:Olfr1288 UTSW 2 111479389 missense probably damaging 1.00
R6329:Olfr1288 UTSW 2 111479228 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCATGTATATTCTATTGGCCAACC -3'
(R):5'- TCCATGCATGCAAGTTTAATGACC -3'

Sequencing Primer
(F):5'- AACCTTTCGCTCATTGACTTGGG -3'
(R):5'- GCATGCAAGTTTAATGACCCTTGG -3'
Posted On2015-06-10