Incidental Mutation 'R4223:Phc3'
ID319439
Institutional Source Beutler Lab
Gene Symbol Phc3
Ensembl Gene ENSMUSG00000037652
Gene Namepolyhomeotic 3
SynonymsHPH3, EDR3, E030046K01Rik
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30899371-30969415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30936819 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 383 (S383R)
Ref Sequence ENSEMBL: ENSMUSP00000096767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046624] [ENSMUST00000064718] [ENSMUST00000099163] [ENSMUST00000108255] [ENSMUST00000129817] [ENSMUST00000152357] [ENSMUST00000168645] [ENSMUST00000177992]
Predicted Effect probably damaging
Transcript: ENSMUST00000046624
AA Change: S416R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037862
Gene: ENSMUSG00000037652
AA Change: S416R

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 512 538 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064718
AA Change: S416R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065617
Gene: ENSMUSG00000037652
AA Change: S416R

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 470 496 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 541 571 N/A INTRINSIC
low complexity region 610 618 N/A INTRINSIC
low complexity region 628 656 N/A INTRINSIC
PDB:2L8E|A 745 781 1e-8 PDB
low complexity region 849 868 N/A INTRINSIC
SAM 884 951 4.04e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099163
AA Change: S383R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096767
Gene: ENSMUSG00000037652
AA Change: S383R

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 300 326 N/A INTRINSIC
low complexity region 360 386 N/A INTRINSIC
low complexity region 479 505 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 550 580 N/A INTRINSIC
low complexity region 619 627 N/A INTRINSIC
low complexity region 637 665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108255
AA Change: S371R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103890
Gene: ENSMUSG00000037652
AA Change: S371R

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124472
Predicted Effect probably damaging
Transcript: ENSMUST00000129817
AA Change: S404R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114916
Gene: ENSMUSG00000037652
AA Change: S404R

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.7e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152357
SMART Domains Protein: ENSMUSP00000117614
Gene: ENSMUSG00000037652

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 201 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168645
AA Change: S404R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130142
Gene: ENSMUSG00000037652
AA Change: S404R

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.6e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177992
AA Change: S371R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136820
Gene: ENSMUSG00000037652
AA Change: S371R

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 288 314 N/A INTRINSIC
low complexity region 348 374 N/A INTRINSIC
low complexity region 467 493 N/A INTRINSIC
low complexity region 519 533 N/A INTRINSIC
low complexity region 538 568 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
low complexity region 625 653 N/A INTRINSIC
PDB:2L8E|A 742 778 8e-9 PDB
low complexity region 846 865 N/A INTRINSIC
SAM 881 948 4.04e-13 SMART
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Phc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Phc3 APN 3 30936475 missense probably damaging 0.98
IGL00985:Phc3 APN 3 30914197 missense probably benign 0.13
IGL01340:Phc3 APN 3 30929884 missense possibly damaging 0.85
IGL01450:Phc3 APN 3 30914504 missense probably damaging 1.00
IGL01546:Phc3 APN 3 30961739 missense probably damaging 1.00
IGL01918:Phc3 APN 3 30914416 critical splice donor site probably null
IGL02178:Phc3 APN 3 30929863 missense possibly damaging 0.47
IGL02210:Phc3 APN 3 30936709 missense probably damaging 0.99
IGL02330:Phc3 APN 3 30936381 missense probably damaging 1.00
IGL02516:Phc3 APN 3 30948793 missense probably damaging 1.00
IGL03030:Phc3 APN 3 30936853 missense probably damaging 1.00
see_saw UTSW 3 30937049 nonsense probably null
R1228:Phc3 UTSW 3 30922255 missense possibly damaging 0.71
R1239:Phc3 UTSW 3 30914130 missense probably damaging 1.00
R1319:Phc3 UTSW 3 30929869 missense probably damaging 0.97
R1521:Phc3 UTSW 3 30936575 missense possibly damaging 0.89
R1772:Phc3 UTSW 3 30961820 missense probably damaging 1.00
R1793:Phc3 UTSW 3 30948716 missense probably damaging 1.00
R1879:Phc3 UTSW 3 30914458 missense probably damaging 1.00
R2171:Phc3 UTSW 3 30950929 missense probably damaging 1.00
R2419:Phc3 UTSW 3 30950878 missense probably damaging 0.99
R2863:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R2864:Phc3 UTSW 3 30914128 missense probably damaging 0.99
R3700:Phc3 UTSW 3 30914128 missense probably damaging 1.00
R3980:Phc3 UTSW 3 30936931 missense probably damaging 0.99
R4222:Phc3 UTSW 3 30936819 missense probably damaging 1.00
R4584:Phc3 UTSW 3 30965882 missense possibly damaging 0.46
R4928:Phc3 UTSW 3 30950919 missense probably damaging 1.00
R5100:Phc3 UTSW 3 30922199 missense possibly damaging 0.71
R5340:Phc3 UTSW 3 30907467 missense probably damaging 1.00
R5656:Phc3 UTSW 3 30965866 missense probably damaging 0.98
R5840:Phc3 UTSW 3 30936583 missense possibly damaging 0.95
R6022:Phc3 UTSW 3 30930025 missense probably damaging 1.00
R6061:Phc3 UTSW 3 30914529 missense probably damaging 1.00
R6177:Phc3 UTSW 3 30942565 missense probably damaging 1.00
R6188:Phc3 UTSW 3 30937049 nonsense probably null
R6866:Phc3 UTSW 3 30914531 nonsense probably null
R6870:Phc3 UTSW 3 30936761 missense probably damaging 1.00
X0025:Phc3 UTSW 3 30965886 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAATGTGTACAACAGGGGATG -3'
(R):5'- TTCAGCCAATCACCCTTCAGAG -3'

Sequencing Primer
(F):5'- TACAACAGGGGATGCTGGAAGTG -3'
(R):5'- TTCAGAGTCCAAGTCAAGATCC -3'
Posted On2015-06-10