Incidental Mutation 'R0395:Acsm2'
ID31944
Institutional Source Beutler Lab
Gene Symbol Acsm2
Ensembl Gene ENSMUSG00000030945
Gene Nameacyl-CoA synthetase medium-chain family member 2
Synonyms
MMRRC Submission 038601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0395 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119554340-119600690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119575746 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 245 (D245N)
Ref Sequence ENSEMBL: ENSMUSP00000126670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084647] [ENSMUST00000098084] [ENSMUST00000130583] [ENSMUST00000167935]
Predicted Effect probably damaging
Transcript: ENSMUST00000084647
AA Change: D245N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081697
Gene: ENSMUSG00000030945
AA Change: D245N

DomainStartEndE-ValueType
Pfam:AMP-binding 57 470 8.9e-79 PFAM
Pfam:AMP-binding_C 478 558 3.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098084
AA Change: D270N

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095690
Gene: ENSMUSG00000030945
AA Change: D270N

DomainStartEndE-ValueType
Pfam:AMP-binding 82 495 9.7e-71 PFAM
Pfam:AMP-binding_C 503 583 5.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129766
SMART Domains Protein: ENSMUSP00000118174
Gene: ENSMUSG00000030945

DomainStartEndE-ValueType
Pfam:AMP-binding 1 144 5.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130583
SMART Domains Protein: ENSMUSP00000115048
Gene: ENSMUSG00000030945

DomainStartEndE-ValueType
Pfam:AMP-binding 57 145 6.7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167935
AA Change: D245N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126670
Gene: ENSMUSG00000030945
AA Change: D245N

DomainStartEndE-ValueType
Pfam:AMP-binding 57 470 9.1e-79 PFAM
Pfam:AMP-binding_C 483 563 3.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209069
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 98% (103/105)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik T C 13: 59,689,656 K205R possibly damaging Het
9630041A04Rik A T 9: 101,942,735 N118I probably damaging Het
Adgrv1 A T 13: 81,385,953 H5836Q probably benign Het
Ahcyl2 T C 6: 29,886,168 V391A probably damaging Het
Alcam A T 16: 52,309,864 M41K probably benign Het
Aldh3b3 A C 19: 3,966,472 E363D probably benign Het
Alk A G 17: 72,603,531 V60A probably damaging Het
Als2cl G A 9: 110,898,084 R906H probably damaging Het
Ap5z1 T C 5: 142,470,562 probably benign Het
Apba2 T A 7: 64,743,408 I547N probably benign Het
Apol10b A T 15: 77,585,640 D112E probably damaging Het
Ash1l C A 3: 89,058,589 R2433S probably damaging Het
Cachd1 T C 4: 100,953,205 F335L probably damaging Het
Cbfa2t3 G T 8: 122,638,951 Q181K probably benign Het
Cct6b A G 11: 82,739,680 M265T probably benign Het
Cd151 G A 7: 141,470,391 V180I probably damaging Het
Ces1h T A 8: 93,357,078 N412I unknown Het
Chmp7 T C 14: 69,732,456 T12A probably benign Het
Clasp1 A G 1: 118,539,331 T534A possibly damaging Het
Cldn15 T A 5: 136,968,198 V31E possibly damaging Het
Col16a1 G A 4: 130,073,109 G583D probably damaging Het
Csmd1 T C 8: 16,346,638 N426S probably damaging Het
Dapp1 C T 3: 137,935,637 C199Y possibly damaging Het
Dchs1 A G 7: 105,758,538 L2029P probably damaging Het
Diexf T C 1: 193,123,676 E187G possibly damaging Het
Dmc1 A G 15: 79,588,772 F158S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Dthd1 T A 5: 62,814,333 N166K possibly damaging Het
Enam A T 5: 88,501,508 Y292F probably damaging Het
Esrrg A T 1: 188,198,635 I285F probably damaging Het
Fam19a2 A T 10: 123,593,592 H37L probably benign Het
Fam50b A G 13: 34,747,237 D232G probably damaging Het
Fam91a1 T A 15: 58,454,792 S792T probably benign Het
Fbxw22 A C 9: 109,381,685 C419W probably damaging Het
Flt4 G A 11: 49,630,343 S393N probably benign Het
Fras1 A T 5: 96,769,653 T3511S possibly damaging Het
Frat2 A C 19: 41,847,824 S30A probably damaging Het
Glp1r T A 17: 30,936,338 M433K probably benign Het
Gm10300 G A 4: 132,074,988 probably benign Het
Gm13178 A G 4: 144,703,195 V408A probably benign Het
Gm684 C T 9: 51,280,534 probably benign Het
Gpatch4 A G 3: 88,054,354 probably benign Het
Gpr22 A T 12: 31,709,462 S220R possibly damaging Het
Grn T C 11: 102,436,223 V549A probably benign Het
Gtf3c5 T C 2: 28,577,918 D177G probably damaging Het
Htr1b A T 9: 81,631,651 M301K probably benign Het
Ifi207 A T 1: 173,729,865 S436T possibly damaging Het
Ifnb1 A T 4: 88,522,529 N82K possibly damaging Het
Ina T G 19: 47,021,919 N384K probably damaging Het
Kirrel2 T C 7: 30,450,458 N541D possibly damaging Het
Lrp2 A T 2: 69,433,077 I4377N possibly damaging Het
Lrrc37a A G 11: 103,464,395 V2532A unknown Het
Mast4 T C 13: 102,735,273 E2529G probably damaging Het
Myh6 T C 14: 54,946,320 H1719R possibly damaging Het
Myo5a A T 9: 75,193,977 H150L probably benign Het
Naglu C T 11: 101,074,107 probably benign Het
Nags G A 11: 102,145,704 A40T unknown Het
Nav1 G T 1: 135,532,621 Y321* probably null Het
Nav1 A T 1: 135,532,623 Y321N probably damaging Het
Neu3 C T 7: 99,813,778 S246N probably benign Het
Npy5r C T 8: 66,681,973 G56D probably benign Het
Nrxn1 A G 17: 91,088,314 V138A possibly damaging Het
Nuggc C T 14: 65,613,472 Q264* probably null Het
Ogfod1 G A 8: 94,063,528 probably null Het
Olfr108 T A 17: 37,445,866 F115Y probably damaging Het
Olfr1453 A G 19: 13,028,299 F10S probably damaging Het
Olfr315 A T 11: 58,778,369 M81L probably benign Het
Olfr490 A G 7: 108,286,271 V285A probably benign Het
Per1 T A 11: 69,102,277 I340N probably damaging Het
Pkhd1 C T 1: 20,381,547 A2175T probably benign Het
Pogk A G 1: 166,403,602 V52A probably damaging Het
Ppib A T 9: 66,066,319 T185S possibly damaging Het
Ptar1 G T 19: 23,720,199 M358I probably damaging Het
Qser1 A C 2: 104,762,881 I1597S probably damaging Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Repin1 C A 6: 48,597,525 R460S probably damaging Het
Sfmbt1 T C 14: 30,787,617 probably benign Het
Sh3rf1 C T 8: 61,393,662 probably benign Het
Shroom3 C T 5: 92,780,903 R106C probably damaging Het
Siglecf T A 7: 43,355,975 V453D probably damaging Het
Slc2a9 A G 5: 38,453,169 S96P probably damaging Het
Slc5a2 A G 7: 128,267,482 Y124C probably damaging Het
Slf1 A G 13: 77,105,969 probably benign Het
Smad1 T G 8: 79,349,782 K269T probably benign Het
Srp54b G A 12: 55,250,099 R194H probably damaging Het
St8sia6 T A 2: 13,665,436 S238C probably damaging Het
Stat3 A T 11: 100,889,937 probably benign Het
Tas1r2 T A 4: 139,655,354 M101K possibly damaging Het
Tesc A G 5: 118,053,582 probably null Het
Tle3 T A 9: 61,410,071 M334K probably damaging Het
Tmem151a A T 19: 5,082,233 V315E probably damaging Het
Tmprss2 T C 16: 97,567,045 D480G probably damaging Het
Trmt1 C A 8: 84,697,112 probably null Het
Tsr3 T C 17: 25,242,224 probably null Het
Ube2u A G 4: 100,481,648 K37E probably benign Het
Usp16 T A 16: 87,475,446 D382E probably damaging Het
Usp9y A T Y: 1,340,053 F1442Y probably damaging Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
V1ra8 C T 6: 90,203,009 L65F possibly damaging Het
Vmn2r10 T C 5: 109,001,993 N395S probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp330 G A 8: 82,764,882 Q221* probably null Het
Other mutations in Acsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Acsm2 APN 7 119573168 missense probably damaging 1.00
IGL00930:Acsm2 APN 7 119592310 missense possibly damaging 0.91
IGL01472:Acsm2 APN 7 119554536 critical splice donor site probably null
IGL01927:Acsm2 APN 7 119578212 missense possibly damaging 0.75
IGL02550:Acsm2 APN 7 119573284 missense probably damaging 1.00
IGL02551:Acsm2 APN 7 119573284 missense probably damaging 1.00
IGL02818:Acsm2 APN 7 119573581 intron probably null
IGL03064:Acsm2 APN 7 119575641 missense probably damaging 0.98
PIT4469001:Acsm2 UTSW 7 119578185 missense possibly damaging 0.51
R0416:Acsm2 UTSW 7 119563556 missense probably benign 0.00
R0783:Acsm2 UTSW 7 119573117 missense probably damaging 1.00
R1252:Acsm2 UTSW 7 119573245 missense probably benign 0.15
R1432:Acsm2 UTSW 7 119573575 missense possibly damaging 0.83
R1494:Acsm2 UTSW 7 119575632 missense probably damaging 1.00
R1495:Acsm2 UTSW 7 119578126 missense probably damaging 1.00
R1642:Acsm2 UTSW 7 119563637 missense probably damaging 1.00
R1702:Acsm2 UTSW 7 119573564 missense possibly damaging 0.88
R2082:Acsm2 UTSW 7 119580634 missense probably benign 0.00
R2420:Acsm2 UTSW 7 119563634 missense probably damaging 1.00
R3612:Acsm2 UTSW 7 119591330 missense probably damaging 0.97
R4396:Acsm2 UTSW 7 119595920 missense probably damaging 1.00
R4433:Acsm2 UTSW 7 119554509 missense unknown
R4568:Acsm2 UTSW 7 119563517 missense probably benign 0.00
R4718:Acsm2 UTSW 7 119573603 missense probably damaging 0.96
R5025:Acsm2 UTSW 7 119554496 missense unknown
R5497:Acsm2 UTSW 7 119573320 missense possibly damaging 0.69
R5509:Acsm2 UTSW 7 119573617 missense probably damaging 1.00
R5682:Acsm2 UTSW 7 119563551 missense probably benign 0.12
R5941:Acsm2 UTSW 7 119591098 missense probably damaging 1.00
R5956:Acsm2 UTSW 7 119554481 missense unknown
R6129:Acsm2 UTSW 7 119591247 unclassified probably null
R6212:Acsm2 UTSW 7 119573282 missense probably damaging 1.00
R7026:Acsm2 UTSW 7 119592227 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCCTGTAGAGAGGCATCCAC -3'
(R):5'- GGAAGAGGACTTTTGCACCCCATTG -3'

Sequencing Primer
(F):5'- ACCATTCATCAGTGTGTGGAGAC -3'
(R):5'- ATCATACCAGTGTGGCTTGAC -3'
Posted On2013-04-24