Incidental Mutation 'R4223:Cyp4x1'
ID319445
Institutional Source Beutler Lab
Gene Symbol Cyp4x1
Ensembl Gene ENSMUSG00000047155
Gene Namecytochrome P450, family 4, subfamily x, polypeptide 1
SynonymsCyp4a28-ps
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115106323-115134281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115112880 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 350 (I350N)
Ref Sequence ENSEMBL: ENSMUSP00000102155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051400] [ENSMUST00000106545]
Predicted Effect probably damaging
Transcript: ENSMUST00000051400
AA Change: I376N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059545
Gene: ENSMUSG00000047155
AA Change: I376N

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
Pfam:p450 46 501 1.5e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106545
AA Change: I350N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102155
Gene: ENSMUSG00000047155
AA Change: I350N

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:p450 20 475 4.7e-118 PFAM
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes and is located within a cluster of genes belonging to this superfamily on chromosome 1. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The expression pattern of a similar rat protein suggests that this protein may be involved in neurovascular function in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Cyp4x1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cyp4x1 APN 4 115121948 missense probably benign 0.00
IGL00913:Cyp4x1 APN 4 115112863 missense probably benign 0.19
IGL02990:Cyp4x1 APN 4 115121749 missense probably benign 0.02
IGL03411:Cyp4x1 APN 4 115108785 missense probably benign 0.05
R0607:Cyp4x1 UTSW 4 115112826 missense probably damaging 1.00
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1148:Cyp4x1 UTSW 4 115126555 splice site probably benign
R1426:Cyp4x1 UTSW 4 115112791 splice site probably benign
R1484:Cyp4x1 UTSW 4 115112901 missense probably damaging 1.00
R1675:Cyp4x1 UTSW 4 115127560 missense possibly damaging 0.94
R1718:Cyp4x1 UTSW 4 115111670 missense possibly damaging 0.75
R2208:Cyp4x1 UTSW 4 115126594 missense probably benign 0.01
R2325:Cyp4x1 UTSW 4 115124379 missense probably benign 0.40
R4588:Cyp4x1 UTSW 4 115108797 missense probably damaging 1.00
R4717:Cyp4x1 UTSW 4 115121705 missense probably benign 0.02
R5522:Cyp4x1 UTSW 4 115121977 missense probably damaging 1.00
R5880:Cyp4x1 UTSW 4 115108721 missense possibly damaging 0.62
R5994:Cyp4x1 UTSW 4 115121945 missense probably benign
R6103:Cyp4x1 UTSW 4 115111667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGGAAGGCCACTGTAGCTC -3'
(R):5'- TGCTTTATCCCAACAGTAATGC -3'

Sequencing Primer
(F):5'- GGCCACTGTAGCTCACATATGATTG -3'
(R):5'- TTATCCCAACAGTAATGCTTACCAGG -3'
Posted On2015-06-10