Incidental Mutation 'R4223:Pcolce'
ID319449
Institutional Source Beutler Lab
Gene Symbol Pcolce
Ensembl Gene ENSMUSG00000029718
Gene Nameprocollagen C-endopeptidase enhancer protein
SynonymsAstt-2, Astt2
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137605103-137613784 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 137605127 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031731] [ENSMUST00000037620] [ENSMUST00000054564] [ENSMUST00000111007] [ENSMUST00000124693] [ENSMUST00000133705] [ENSMUST00000142675] [ENSMUST00000154708] [ENSMUST00000155251] [ENSMUST00000197912]
Predicted Effect probably benign
Transcript: ENSMUST00000031731
SMART Domains Protein: ENSMUSP00000031731
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 158 272 3e-46 SMART
low complexity region 299 314 N/A INTRINSIC
low complexity region 323 338 N/A INTRINSIC
C345C 352 458 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037620
SMART Domains Protein: ENSMUSP00000040828
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 133 1.2e-17 PFAM
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 213 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054564
SMART Domains Protein: ENSMUSP00000057002
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 36 148 3.79e-43 SMART
CUB 183 297 3e-46 SMART
low complexity region 324 339 N/A INTRINSIC
low complexity region 348 363 N/A INTRINSIC
C345C 377 483 3.92e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111007
SMART Domains Protein: ENSMUSP00000106636
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 132 3.5e-17 PFAM
transmembrane domain 176 198 N/A INTRINSIC
transmembrane domain 213 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124693
SMART Domains Protein: ENSMUSP00000120749
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
Pfam:CUB 1 63 2.4e-12 PFAM
Pfam:CUB 76 124 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131703
Predicted Effect probably benign
Transcript: ENSMUST00000133705
SMART Domains Protein: ENSMUSP00000122462
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
SCOP:d1grwa_ 34 74 7e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137210
Predicted Effect probably benign
Transcript: ENSMUST00000142675
SMART Domains Protein: ENSMUSP00000115654
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 18 130 3.79e-43 SMART
CUB 140 214 2.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148662
Predicted Effect probably benign
Transcript: ENSMUST00000154708
SMART Domains Protein: ENSMUSP00000116851
Gene: ENSMUSG00000037221

DomainStartEndE-ValueType
Pfam:Motile_Sperm 33 132 2.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155251
SMART Domains Protein: ENSMUSP00000121575
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 8 111 1.92e-21 SMART
Pfam:CUB 121 169 1.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196366
Predicted Effect probably benign
Transcript: ENSMUST00000197912
SMART Domains Protein: ENSMUSP00000142608
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 1 107 2.2e-36 SMART
C345C 130 236 1.3e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198801
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibrillar collagen types I-III are synthesized as precursor molecules known as procollagens. These precursors contain amino- and carboxyl-terminal peptide extensions known as N- and C-propeptides, respectively, which are cleaved, upon secretion of procollagen from the cell, to yield the mature triple helical, highly structured fibrils. This gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in thickened cortical and trabecular bone and abnormal collagen fibrils in both mineralized and nonmineralized tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Pcolce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Pcolce APN 5 137607476 missense probably damaging 0.98
IGL01566:Pcolce APN 5 137605160 utr 3 prime probably benign
R0157:Pcolce UTSW 5 137610479 unclassified probably null
R1585:Pcolce UTSW 5 137610507 nonsense probably null
R2307:Pcolce UTSW 5 137609094 missense probably damaging 0.99
R2507:Pcolce UTSW 5 137607051 missense possibly damaging 0.93
R3700:Pcolce UTSW 5 137609047 missense probably damaging 0.98
R4011:Pcolce UTSW 5 137605774 missense probably benign 0.00
R4983:Pcolce UTSW 5 137605674 intron probably benign
R5141:Pcolce UTSW 5 137605750 missense probably benign 0.05
R5626:Pcolce UTSW 5 137610399 missense probably damaging 0.99
R6223:Pcolce UTSW 5 137605299 missense probably damaging 1.00
R6241:Pcolce UTSW 5 137605234 missense probably benign 0.00
R6643:Pcolce UTSW 5 137608903 missense probably damaging 0.97
R6938:Pcolce UTSW 5 137605616 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CTGGCCCCTATCATATATTCTTAAGAG -3'
(R):5'- GCCAGTTATCTGCTGATGGG -3'

Sequencing Primer
(F):5'- TTTGAACTCAGGAGCCTAGC -3'
(R):5'- CTGATGGGTCAGGTGGAAG -3'
Posted On2015-06-10