Incidental Mutation 'R4223:Rfc3'
ID319450
Institutional Source Beutler Lab
Gene Symbol Rfc3
Ensembl Gene ENSMUSG00000033970
Gene Namereplication factor C (activator 1) 3
Synonyms2810416I22Rik, Recc3, 38kDa, 38kDa
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R4223 (G1)
Quality Score118
Status Validated
Chromosome5
Chromosomal Location151642756-151651242 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 151651172 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038131]
Predicted Effect probably benign
Transcript: ENSMUST00000038131
SMART Domains Protein: ENSMUSP00000039621
Gene: ENSMUSG00000033970

DomainStartEndE-ValueType
AAA 34 190 1.5e-6 SMART
Pfam:Rep_fac_C 216 338 7.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145106
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the accessory proteins proliferating cell nuclear antigen (PCNA) and replication factor C (RFC). RFC, also named activator 1, is a protein complex consisting of five distinct subunits of 140, 40, 38, 37, and 36 kDa. This gene encodes the 38 kDa subunit. This subunit is essential for the interaction between the 140 kDa subunit and the core complex that consists of the 36, 37, and 40 kDa subunits. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Rfc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Rfc3 APN 5 151642936 missense probably benign 0.00
IGL02429:Rfc3 APN 5 151651131 missense probably benign 0.01
IGL02588:Rfc3 APN 5 151642916 missense possibly damaging 0.69
IGL02878:Rfc3 APN 5 151642914 makesense probably null
IGL03109:Rfc3 APN 5 151643094 missense probably benign 0.10
R0129:Rfc3 UTSW 5 151651151 start codon destroyed probably null 1.00
R0456:Rfc3 UTSW 5 151647523 missense possibly damaging 0.61
R2015:Rfc3 UTSW 5 151647538 critical splice acceptor site probably null
R2096:Rfc3 UTSW 5 151644918 missense probably benign 0.03
R2306:Rfc3 UTSW 5 151643778 missense probably damaging 1.00
R4739:Rfc3 UTSW 5 151644776 splice site probably benign
R4906:Rfc3 UTSW 5 151647495 missense probably damaging 0.98
R4945:Rfc3 UTSW 5 151642985 missense probably damaging 1.00
R5643:Rfc3 UTSW 5 151649979 missense probably benign 0.05
R5644:Rfc3 UTSW 5 151649979 missense probably benign 0.05
R6011:Rfc3 UTSW 5 151643719 missense probably damaging 1.00
R6181:Rfc3 UTSW 5 151647520 missense probably damaging 1.00
R6883:Rfc3 UTSW 5 151648284 missense probably benign 0.00
Z1088:Rfc3 UTSW 5 151644862 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAGGAACGCGTCACTCTG -3'
(R):5'- AAATCCAGCGACTGTTGGTG -3'

Sequencing Primer
(F):5'- TGACCCCCTCGCTAGCAC -3'
(R):5'- TGCAGTGGTGGAAGTGGGAAC -3'
Posted On2015-06-10