Incidental Mutation 'R4223:Ptbp1'
ID319467
Institutional Source Beutler Lab
Gene Symbol Ptbp1
Ensembl Gene ENSMUSG00000006498
Gene Namepolypyrimidine tract binding protein 1
SynonymsPtb, hnRNP I
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79854427-79864771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79859213 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 125 (I125T)
Ref Sequence ENSEMBL: ENSMUSP00000059481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000095457] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000167250] [ENSMUST00000168683] [ENSMUST00000169483] [ENSMUST00000171599] [ENSMUST00000172282]
Predicted Effect probably benign
Transcript: ENSMUST00000057343
AA Change: I125T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498
AA Change: I125T

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
AA Change: I85T

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498
AA Change: I85T

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165153
Predicted Effect probably benign
Transcript: ENSMUST00000165704
AA Change: I125T

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498
AA Change: I125T

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166593
Predicted Effect probably benign
Transcript: ENSMUST00000167250
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168521
Predicted Effect probably benign
Transcript: ENSMUST00000168683
SMART Domains Protein: ENSMUSP00000132383
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
SCOP:d2u1a__ 17 55 3e-3 SMART
PDB:2AD9|A 18 55 9e-19 PDB
Blast:RRM 29 55 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168988
Predicted Effect unknown
Transcript: ENSMUST00000169091
AA Change: I75T
SMART Domains Protein: ENSMUSP00000128449
Gene: ENSMUSG00000006498
AA Change: I75T

DomainStartEndE-ValueType
low complexity region 13 19 N/A INTRINSIC
Pfam:RRM_5 29 81 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169483
SMART Domains Protein: ENSMUSP00000127507
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171216
Predicted Effect probably benign
Transcript: ENSMUST00000171599
SMART Domains Protein: ENSMUSP00000131296
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 87 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172282
AA Change: I125T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498
AA Change: I125T

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217802
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA-binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has four repeats of quasi-RNA recognition motif (RRM) domains that bind RNAs. This protein binds to the intronic polypyrimidine tracts that requires pre-mRNA splicing and acts via the protein degradation ubiquitin-proteasome pathway. It may also promote the binding of U2 snRNP to pre-mRNAs. This protein is localized in the nucleoplasm and it is also detected in the perinucleolar structure. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E6.5. Mice homozygous for a conditional allele activated in neuronal stem cells (NSCs) exhibit premature death, and non-obstructive hydrocephaly with loss of ependymal cells due to precocious NSC differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Ptbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Ptbp1 APN 10 79859962 splice site probably benign
IGL01335:Ptbp1 APN 10 79862874 splice site probably null
IGL03119:Ptbp1 APN 10 79859624 missense probably damaging 1.00
R1433:Ptbp1 UTSW 10 79863273 missense probably damaging 1.00
R2418:Ptbp1 UTSW 10 79859677 missense probably damaging 0.98
R4222:Ptbp1 UTSW 10 79859213 missense probably benign 0.07
R4224:Ptbp1 UTSW 10 79859213 missense probably benign 0.07
R4688:Ptbp1 UTSW 10 79856508 missense possibly damaging 0.87
R5841:Ptbp1 UTSW 10 79859932 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTCCAGAGTCATCCATGTCAG -3'
(R):5'- AAGGCCAGGTTTCCAGACTG -3'

Sequencing Primer
(F):5'- GAGTCATCCATGTCAGAAAGCTGC -3'
(R):5'- ACTGGACGGAGTTTACAG -3'
Posted On2015-06-10