Incidental Mutation 'R4223:Acap1'
ID319471
Institutional Source Beutler Lab
Gene Symbol Acap1
Ensembl Gene ENSMUSG00000001588
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 1
SynonymsCentb1
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69881567-69895539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69883685 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 396 (S396P)
Ref Sequence ENSEMBL: ENSMUSP00000104262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000050555] [ENSMUST00000108622]
Predicted Effect probably damaging
Transcript: ENSMUST00000001631
AA Change: S584P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588
AA Change: S584P

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050555
SMART Domains Protein: ENSMUSP00000059107
Gene: ENSMUSG00000046731

DomainStartEndE-ValueType
Pfam:BTB_2 1 73 1.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108622
AA Change: S396P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104262
Gene: ENSMUSG00000001588
AA Change: S396P

DomainStartEndE-ValueType
PH 78 174 4.42e-15 SMART
ArfGap 217 339 2.42e-50 SMART
ANK 418 447 4.01e0 SMART
ANK 451 480 3.04e0 SMART
ANK 484 514 4.18e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198919
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Acap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Acap1 APN 11 69882691 missense possibly damaging 0.95
IGL01148:Acap1 APN 11 69890903 nonsense probably null
IGL01398:Acap1 APN 11 69881722 missense probably damaging 1.00
IGL01583:Acap1 APN 11 69881677 missense probably damaging 1.00
IGL02002:Acap1 APN 11 69884460 missense probably damaging 1.00
IGL02078:Acap1 APN 11 69895286 missense probably damaging 1.00
IGL02083:Acap1 APN 11 69889510 missense possibly damaging 0.74
IGL02535:Acap1 APN 11 69882694 missense probably benign 0.02
IGL02669:Acap1 APN 11 69894595 unclassified probably benign
IGL03125:Acap1 APN 11 69887038 missense probably damaging 1.00
autobot UTSW 11 69881722 missense probably damaging 1.00
R0127:Acap1 UTSW 11 69887217 splice site probably benign
R0243:Acap1 UTSW 11 69885426 missense probably damaging 0.98
R0604:Acap1 UTSW 11 69884625 missense probably benign 0.01
R0863:Acap1 UTSW 11 69887056 missense probably damaging 0.98
R1331:Acap1 UTSW 11 69882376 splice site probably null
R1911:Acap1 UTSW 11 69881722 missense probably damaging 1.00
R1994:Acap1 UTSW 11 69889498 missense probably benign 0.41
R2411:Acap1 UTSW 11 69885485 missense probably damaging 1.00
R2442:Acap1 UTSW 11 69889491 missense possibly damaging 0.46
R2910:Acap1 UTSW 11 69887076 splice site probably benign
R4164:Acap1 UTSW 11 69890037 missense probably benign 0.22
R4562:Acap1 UTSW 11 69885351 intron probably benign
R4676:Acap1 UTSW 11 69889468 missense probably benign 0.22
R4852:Acap1 UTSW 11 69884376 missense probably benign 0.30
R4921:Acap1 UTSW 11 69887193 missense probably damaging 0.98
R4928:Acap1 UTSW 11 69885815 missense possibly damaging 0.81
R5536:Acap1 UTSW 11 69889307 missense probably benign 0.11
R5886:Acap1 UTSW 11 69884336 missense probably benign
R6053:Acap1 UTSW 11 69887070 critical splice acceptor site probably null
R6196:Acap1 UTSW 11 69887067 missense probably damaging 0.98
R6220:Acap1 UTSW 11 69889679 missense probably damaging 0.99
R6295:Acap1 UTSW 11 69890587 critical splice donor site probably null
R6333:Acap1 UTSW 11 69883601 missense possibly damaging 0.65
R6414:Acap1 UTSW 11 69884336 missense probably benign
R6848:Acap1 UTSW 11 69884661 missense probably damaging 1.00
R6952:Acap1 UTSW 11 69885517 missense probably benign 0.30
X0012:Acap1 UTSW 11 69881689 missense probably damaging 1.00
X0027:Acap1 UTSW 11 69881723 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACCCTGATGAGTCATGC -3'
(R):5'- TGACTTATCCCACTGCAGCAC -3'

Sequencing Primer
(F):5'- GCATGAGCTCCTAACCTCTGAG -3'
(R):5'- CACCTGGGGACTTTGCTGAAG -3'
Posted On2015-06-10