Incidental Mutation 'R4223:Phf1'
ID319485
Institutional Source Beutler Lab
Gene Symbol Phf1
Ensembl Gene ENSMUSG00000024193
Gene NamePHD finger protein 1
SynonymsTctex3, Tctex-3, D17Ertd455e, mPcl1, PHF2
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26933127-26937890 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 26937500 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 539 (R539*)
Ref Sequence ENSEMBL: ENSMUSP00000073402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025027] [ENSMUST00000073724] [ENSMUST00000078961] [ENSMUST00000114935] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000229490]
Predicted Effect probably benign
Transcript: ENSMUST00000025027
SMART Domains Protein: ENSMUSP00000025027
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
Pfam:CutA1 67 165 6.9e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073724
AA Change: R539*
SMART Domains Protein: ENSMUSP00000073402
Gene: ENSMUSG00000024193
AA Change: R539*

DomainStartEndE-ValueType
TUDOR 29 86 5.61e-11 SMART
PHD 89 140 2.81e-8 SMART
PHD 188 238 2.42e0 SMART
low complexity region 410 416 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
Pfam:Mtf2_C 523 557 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078961
SMART Domains Protein: ENSMUSP00000077984
Gene: ENSMUSG00000024301

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
KISc 307 670 1.34e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114935
SMART Domains Protein: ENSMUSP00000110585
Gene: ENSMUSG00000024194

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CutA1 43 144 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184739
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201702
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229490
Meta Mutation Damage Score 0.6128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the polycomb-like protein family, which is a component of polycomb repressive complex-2. This complex represses gene expression by catalyzing the trimethylation of histone H3 lysine 27 and is required for the regulation of developmental genes including homeotic genes. The gene is expressed primarily in testis tissue. Small interfering RNA-mediated knockdown in cultured cell lines results in changes in homeotic gene expression coincident with alterations in promoter methylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Phf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Phf1 APN 17 26936594 missense possibly damaging 0.90
IGL01629:Phf1 APN 17 26934273 missense probably benign 0.07
IGL01931:Phf1 APN 17 26935535 unclassified probably benign
IGL02008:Phf1 APN 17 26935286 missense possibly damaging 0.95
IGL02048:Phf1 APN 17 26934541 unclassified probably benign
IGL02206:Phf1 APN 17 26936869 unclassified probably benign
IGL02252:Phf1 APN 17 26935135 missense possibly damaging 0.65
IGL02548:Phf1 APN 17 26935626 missense probably damaging 1.00
IGL03145:Phf1 APN 17 26934370 critical splice donor site probably null
R0539:Phf1 UTSW 17 26934458 unclassified probably null
R0815:Phf1 UTSW 17 26937140 unclassified probably benign
R0863:Phf1 UTSW 17 26937140 unclassified probably benign
R1028:Phf1 UTSW 17 26934333 missense possibly damaging 0.90
R1083:Phf1 UTSW 17 26937270 unclassified probably benign
R1537:Phf1 UTSW 17 26935398 critical splice donor site probably null
R1587:Phf1 UTSW 17 26937492 missense probably damaging 0.99
R1656:Phf1 UTSW 17 26937359 missense possibly damaging 0.93
R1956:Phf1 UTSW 17 26935745 splice site probably null
R2566:Phf1 UTSW 17 26937088 missense probably damaging 1.00
R3196:Phf1 UTSW 17 26934455 missense probably damaging 1.00
R4835:Phf1 UTSW 17 26934678 missense probably benign
R6439:Phf1 UTSW 17 26936612 missense probably benign
X0028:Phf1 UTSW 17 26936188 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACATTGGCTTCCCCACAGAC -3'
(R):5'- AAGAGGACCTCTTCACTCCC -3'

Sequencing Primer
(F):5'- CCCTAAAAGTTCACCCCACTCAG -3'
(R):5'- TGGATTCCAGCCTGGGCAG -3'
Posted On2015-06-10