Incidental Mutation 'R4223:Galnt1'
ID319487
Institutional Source Beutler Lab
Gene Symbol Galnt1
Ensembl Gene ENSMUSG00000000420
Gene Namepolypeptide N-acetylgalactosaminyltransferase 1
SynonymsppGaNTase-T1
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location24205344-24286818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24238356 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 4 (F4L)
Ref Sequence ENSEMBL: ENSMUSP00000131755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000430] [ENSMUST00000164998] [ENSMUST00000170243] [ENSMUST00000171583] [ENSMUST00000178605]
Predicted Effect probably benign
Transcript: ENSMUST00000000430
AA Change: F4L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000430
Gene: ENSMUSG00000000420
AA Change: F4L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 3.2e-11 PFAM
Pfam:Glycos_transf_2 119 303 3.1e-40 PFAM
Pfam:Glyco_transf_7C 281 349 9.1e-10 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164998
AA Change: F4L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132411
Gene: ENSMUSG00000000420
AA Change: F4L

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
PDB:1XHB|A 88 142 1e-30 PDB
SCOP:d1qg8a_ 116 141 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170243
AA Change: F4L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000132142
Gene: ENSMUSG00000000420
AA Change: F4L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171583
AA Change: F4L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131755
Gene: ENSMUSG00000000420
AA Change: F4L

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178605
AA Change: F4L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137427
Gene: ENSMUSG00000000420
AA Change: F4L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. Transcript variants derived from this gene that utilize alternative polyA signals have been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, increased bleeding time, decreased T and B cells, impaired leukocyte rolling, decreased IgG levels, and hypoalbuminemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc12a2 T A 18: 57,910,256 S591T probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Galnt1 APN 18 24267560 missense probably damaging 1.00
IGL02373:Galnt1 APN 18 24280035 missense possibly damaging 0.68
IGL02998:Galnt1 APN 18 24264412 missense probably damaging 1.00
IGL03080:Galnt1 APN 18 24269517 missense probably damaging 0.99
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0463:Galnt1 UTSW 18 24254525 missense probably benign 0.01
R1183:Galnt1 UTSW 18 24271590 missense probably damaging 1.00
R1954:Galnt1 UTSW 18 24271774 splice site probably benign
R2349:Galnt1 UTSW 18 24280028 missense probably benign 0.03
R3739:Galnt1 UTSW 18 24271655 missense probably benign 0.27
R5001:Galnt1 UTSW 18 24271755 missense probably benign
R5410:Galnt1 UTSW 18 24267547 missense probably benign 0.02
R5516:Galnt1 UTSW 18 24280017 missense probably benign 0.00
R5685:Galnt1 UTSW 18 24264529 missense possibly damaging 0.81
R5687:Galnt1 UTSW 18 24272750 missense probably benign 0.00
R5735:Galnt1 UTSW 18 24264520 missense possibly damaging 0.64
R6106:Galnt1 UTSW 18 24254663 missense probably benign 0.31
R6222:Galnt1 UTSW 18 24264534 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTGATTGACTCTTACAGCTTTTG -3'
(R):5'- ATGACCAATCTCCTTAAGAAGACAG -3'

Sequencing Primer
(F):5'- TGAGACTGGAATAGTAGCTTACTGC -3'
(R):5'- TCTCCTTAAGAAGACAGCTGTAC -3'
Posted On2015-06-10