Incidental Mutation 'R4223:Slc12a2'
ID319489
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Namesolute carrier family 12, member 2
SynonymsNkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters
MMRRC Submission 041043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4223 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location57878678-57946821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57910256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 591 (S591T)
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
Predicted Effect probably damaging
Transcript: ENSMUST00000115366
AA Change: S591T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: S591T

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A G 10: 79,094,452 Y43H probably damaging Het
Aamp A T 1: 74,281,126 L348Q probably damaging Het
Abcb1b T A 5: 8,813,722 L226M probably damaging Het
Acap1 A G 11: 69,883,685 S396P probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp1a3 T C 7: 25,000,930 D48G probably benign Het
Bhmt-ps1 T A 4: 26,369,352 noncoding transcript Het
C130026I21Rik T C 1: 85,112,557 D83G probably damaging Het
Ccdc116 A G 16: 17,146,945 probably benign Het
Cmtm5 T A 14: 54,937,919 C51S probably damaging Het
Cyb5rl T C 4: 107,080,988 V214A probably damaging Het
Cyp4x1 A T 4: 115,112,880 I350N probably damaging Het
Efcab6 C A 15: 83,867,108 D1498Y probably damaging Het
Eif3c C G 7: 126,566,299 probably benign Het
Epha3 G A 16: 63,583,539 S733L probably damaging Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Galnt1 T C 18: 24,238,356 F4L probably benign Het
Glis1 T C 4: 107,567,845 S218P probably benign Het
Gm15854 A T 6: 129,972,463 noncoding transcript Het
Gm29125 T C 1: 80,383,519 noncoding transcript Het
Inpp5a T C 7: 139,558,905 V263A possibly damaging Het
Itgb1 T G 8: 128,714,143 I255S probably damaging Het
Kcp A G 6: 29,482,258 L1547P possibly damaging Het
Kifc3 C A 8: 95,109,982 L72F probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrrc55 G A 2: 85,196,116 A188V possibly damaging Het
Ly6i A T 15: 74,983,035 S9T probably benign Het
Mfsd14b C T 13: 65,066,608 probably benign Het
Nipsnap3a T A 4: 52,997,251 D172E probably benign Het
Olfr1288 A T 2: 111,479,144 Y120F probably benign Het
Oxgr1 T C 14: 120,022,613 K61E probably damaging Het
Pak2 G T 16: 32,052,210 N51K probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pcolce T A 5: 137,605,127 probably benign Het
Phc3 A T 3: 30,936,819 S383R probably damaging Het
Phf1 C T 17: 26,937,500 R539* probably null Het
Plch1 G A 3: 63,701,900 T48I probably damaging Het
Plekha2 A G 8: 25,043,020 S312P probably damaging Het
Pnpla7 T C 2: 24,982,114 F69L possibly damaging Het
Ppcdc T A 9: 57,414,715 M181L possibly damaging Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rfc3 C A 5: 151,651,172 probably benign Het
Rpa2 T G 4: 132,776,744 I69S probably damaging Het
Rtn4 G A 11: 29,706,856 V337I probably benign Het
Rttn T C 18: 89,095,584 L1709P probably damaging Het
Sh2b2 G A 5: 136,219,053 P548L possibly damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc38a9 G A 13: 112,714,248 probably null Het
Slc9a4 T C 1: 40,619,126 V603A probably damaging Het
Snx19 T G 9: 30,428,448 V294G possibly damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Strn3 C T 12: 51,627,855 R382Q probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Trps1 A G 15: 50,846,648 V98A probably benign Het
Vmn1r220 T A 13: 23,183,978 M183L probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Xirp2 A T 2: 67,516,493 E3026V possibly damaging Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 57936405 missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 57906020 nonsense probably null
IGL01896:Slc12a2 APN 18 57896308 missense probably benign 0.06
IGL02266:Slc12a2 APN 18 57912020 splice site probably benign
IGL02489:Slc12a2 APN 18 57912002 missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 57879399 missense probably benign 0.25
IGL03068:Slc12a2 APN 18 57904335 splice site probably benign
IGL03076:Slc12a2 APN 18 57926397 splice site probably benign
IGL03086:Slc12a2 APN 18 57921784 missense probably benign 0.00
IGL03238:Slc12a2 APN 18 57914234 missense possibly damaging 0.85
frankie UTSW 18 57934963 missense possibly damaging 0.48
sugar UTSW 18 57899272 missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 57915522 splice site probably benign
R0194:Slc12a2 UTSW 18 57930211 missense probably damaging 1.00
R0530:Slc12a2 UTSW 18 57919536 missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 57904378 missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 57921810 missense probably benign 0.00
R1112:Slc12a2 UTSW 18 57937752 missense probably benign 0.01
R1544:Slc12a2 UTSW 18 57879302 missense probably benign 0.00
R1669:Slc12a2 UTSW 18 57904235 missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 57904353 missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 57879395 missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 57910286 missense possibly damaging 0.61
R2340:Slc12a2 UTSW 18 57900050 missense probably benign 0.03
R3971:Slc12a2 UTSW 18 57930196 missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 57899355 missense possibly damaging 0.95
R4541:Slc12a2 UTSW 18 57912965 intron probably null
R4678:Slc12a2 UTSW 18 57905960 nonsense probably null
R4931:Slc12a2 UTSW 18 57934963 missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 57899272 missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 57879020 missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 57896310 missense possibly damaging 0.83
R5726:Slc12a2 UTSW 18 57896354 missense probably benign 0.01
R5789:Slc12a2 UTSW 18 57912019 splice site probably null
R5868:Slc12a2 UTSW 18 57943996 missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 57932523 missense probably benign 0.06
R6126:Slc12a2 UTSW 18 57944044 missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 57915506 missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 57898073 missense probably benign 0.01
R6615:Slc12a2 UTSW 18 57898128 missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 57919469 missense probably benign 0.05
R6957:Slc12a2 UTSW 18 57910272 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACGCCTTTAAGGATGTTTTAGTAG -3'
(R):5'- CAATGTTTGAACAGTCCTACATAGC -3'

Sequencing Primer
(F):5'- GCTATTACCAGATTCCTTTCAG -3'
(R):5'- CAAACACTTTCAGATAAAGGT -3'
Posted On2015-06-10