Incidental Mutation 'R4176:Trip11'
ID319525
Institutional Source Beutler Lab
Gene Symbol Trip11
Ensembl Gene ENSMUSG00000021188
Gene Namethyroid hormone receptor interactor 11
SynonymsGMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230
MMRRC Submission 041014-MU
Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location101834043-101913267 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 101895698 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 203 (Q203*)
Ref Sequence ENSEMBL: ENSMUSP00000135669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]
Predicted Effect probably null
Transcript: ENSMUST00000021605
AA Change: Q204*
SMART Domains Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: Q204*

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 54 130 N/A INTRINSIC
coiled coil region 167 194 N/A INTRINSIC
coiled coil region 218 702 N/A INTRINSIC
coiled coil region 754 990 N/A INTRINSIC
coiled coil region 1022 1051 N/A INTRINSIC
coiled coil region 1196 1261 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
coiled coil region 1336 1481 N/A INTRINSIC
coiled coil region 1547 1657 N/A INTRINSIC
coiled coil region 1681 1771 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176728
AA Change: Q204*
SMART Domains Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188
AA Change: Q204*

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
Pfam:Orthopox_A5L 48 282 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177183
SMART Domains Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188

DomainStartEndE-ValueType
coiled coil region 33 158 N/A INTRINSIC
coiled coil region 179 417 N/A INTRINSIC
coiled coil region 469 705 N/A INTRINSIC
coiled coil region 737 766 N/A INTRINSIC
coiled coil region 911 976 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
coiled coil region 1051 1196 N/A INTRINSIC
coiled coil region 1262 1372 N/A INTRINSIC
coiled coil region 1396 1486 N/A INTRINSIC
low complexity region 1649 1660 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177536
AA Change: Q203*
SMART Domains Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188
AA Change: Q203*

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
coiled coil region 53 129 N/A INTRINSIC
coiled coil region 166 193 N/A INTRINSIC
coiled coil region 217 517 N/A INTRINSIC
Meta Mutation Damage Score 0.6424 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Trip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Trip11 APN 12 101886147 missense probably benign 0.37
IGL00484:Trip11 APN 12 101885311 nonsense probably null
IGL00972:Trip11 APN 12 101894337 missense probably null 1.00
IGL01476:Trip11 APN 12 101898911 missense probably damaging 0.96
IGL01591:Trip11 APN 12 101883345 missense probably damaging 0.98
IGL01667:Trip11 APN 12 101878862 missense probably damaging 1.00
IGL01764:Trip11 APN 12 101884631 missense probably damaging 1.00
IGL01789:Trip11 APN 12 101871831 missense probably benign 0.05
IGL01814:Trip11 APN 12 101884488 missense probably damaging 0.98
IGL01898:Trip11 APN 12 101885676 missense probably benign
IGL01924:Trip11 APN 12 101886884 missense possibly damaging 0.93
IGL02020:Trip11 APN 12 101884313 missense probably damaging 1.00
IGL02475:Trip11 APN 12 101895683 missense probably benign 0.01
IGL02544:Trip11 APN 12 101893521 missense probably damaging 1.00
IGL02678:Trip11 APN 12 101883390 missense probably damaging 0.96
IGL02714:Trip11 APN 12 101884001 missense probably damaging 1.00
IGL02718:Trip11 APN 12 101886025 missense probably benign 0.24
IGL02904:Trip11 APN 12 101886838 missense probably damaging 1.00
IGL03012:Trip11 APN 12 101883936 missense probably damaging 1.00
IGL03191:Trip11 APN 12 101898925 missense probably damaging 1.00
IGL03327:Trip11 APN 12 101883418 missense possibly damaging 0.87
IGL03337:Trip11 APN 12 101885019 missense probably damaging 1.00
NA:Trip11 UTSW 12 101894321 unclassified probably null
R0027:Trip11 UTSW 12 101885169 missense probably benign 0.00
R0028:Trip11 UTSW 12 101884757 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0238:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0239:Trip11 UTSW 12 101884728 missense probably damaging 1.00
R0505:Trip11 UTSW 12 101885672 missense probably damaging 0.98
R0556:Trip11 UTSW 12 101884518 nonsense probably null
R0573:Trip11 UTSW 12 101886860 missense probably benign 0.02
R0626:Trip11 UTSW 12 101885976 missense possibly damaging 0.54
R1519:Trip11 UTSW 12 101886160 missense probably benign 0.04
R1530:Trip11 UTSW 12 101912767 missense unknown
R1647:Trip11 UTSW 12 101884392 nonsense probably null
R1648:Trip11 UTSW 12 101884392 nonsense probably null
R1856:Trip11 UTSW 12 101883333 nonsense probably null
R2013:Trip11 UTSW 12 101837722 missense probably damaging 1.00
R2017:Trip11 UTSW 12 101885360 missense probably benign 0.00
R2206:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2207:Trip11 UTSW 12 101873442 missense probably benign 0.25
R2304:Trip11 UTSW 12 101898977 missense possibly damaging 0.58
R2328:Trip11 UTSW 12 101878827 makesense probably null
R2513:Trip11 UTSW 12 101837727 missense possibly damaging 0.94
R3499:Trip11 UTSW 12 101893694 missense possibly damaging 0.87
R4105:Trip11 UTSW 12 101894322 nonsense probably null
R4124:Trip11 UTSW 12 101895698 nonsense probably null
R4126:Trip11 UTSW 12 101895698 nonsense probably null
R4128:Trip11 UTSW 12 101895698 nonsense probably null
R4175:Trip11 UTSW 12 101895698 nonsense probably null
R4181:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4296:Trip11 UTSW 12 101885868 nonsense probably null
R4302:Trip11 UTSW 12 101893768 missense probably damaging 1.00
R4306:Trip11 UTSW 12 101886939 missense probably benign
R4342:Trip11 UTSW 12 101884316 missense probably damaging 1.00
R4576:Trip11 UTSW 12 101886240 nonsense probably null
R4586:Trip11 UTSW 12 101883341 missense possibly damaging 0.55
R4634:Trip11 UTSW 12 101837616 missense probably damaging 1.00
R4696:Trip11 UTSW 12 101885290 missense possibly damaging 0.71
R4792:Trip11 UTSW 12 101885446 missense probably benign 0.10
R4903:Trip11 UTSW 12 101886806 critical splice donor site probably null
R5001:Trip11 UTSW 12 101884910 nonsense probably null
R5017:Trip11 UTSW 12 101846620 missense probably benign 0.00
R5227:Trip11 UTSW 12 101884920 missense probably damaging 1.00
R5231:Trip11 UTSW 12 101885601 missense probably damaging 0.96
R5539:Trip11 UTSW 12 101885127 missense probably damaging 0.98
R5754:Trip11 UTSW 12 101885665 nonsense probably null
R5755:Trip11 UTSW 12 101885665 nonsense probably null
R5890:Trip11 UTSW 12 101885972 missense probably damaging 0.99
R5910:Trip11 UTSW 12 101883479 missense probably damaging 1.00
R6083:Trip11 UTSW 12 101889742 missense probably benign 0.00
R6208:Trip11 UTSW 12 101898895 missense probably damaging 1.00
R6216:Trip11 UTSW 12 101890600 missense probably benign 0.31
R6315:Trip11 UTSW 12 101885578 missense possibly damaging 0.84
R6413:Trip11 UTSW 12 101885531 missense probably benign 0.12
R6590:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6690:Trip11 UTSW 12 101885451 missense possibly damaging 0.92
R6914:Trip11 UTSW 12 101846620 missense probably benign 0.00
R6938:Trip11 UTSW 12 101837627 missense probably damaging 0.98
R7015:Trip11 UTSW 12 101893683 missense probably damaging 1.00
R7023:Trip11 UTSW 12 101885867 missense probably benign 0.13
R7133:Trip11 UTSW 12 101884070 missense probably damaging 0.97
R7271:Trip11 UTSW 12 101884352 missense probably damaging 1.00
R7424:Trip11 UTSW 12 101885198 missense probably damaging 1.00
R7431:Trip11 UTSW 12 101884019 missense possibly damaging 0.84
X0020:Trip11 UTSW 12 101885913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACACACAGACCTAGGATTACTGAG -3'
(R):5'- TGGCATTAGTACTGGGGAACTTTC -3'

Sequencing Primer
(F):5'- ACAGACCTAGGATTACTGAGAAAAC -3'
(R):5'- AGTACTGGGGAACTTTCTATCATC -3'
Posted On2015-06-10