Incidental Mutation 'R4178:Cfap44'
ID319610
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
MMRRC Submission 040864-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4178 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44451853 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1323 (L1323Q)
Ref Sequence ENSEMBL: ENSMUSP00000113908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099742
AA Change: L1323Q

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: L1323Q

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120049
AA Change: L1323Q

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: L1323Q

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl A G 14: 34,054,971 probably null Het
Atp2b2 A T 6: 113,793,718 V410E probably damaging Het
C6 G A 15: 4,735,139 V106I probably benign Het
Cdhr1 A C 14: 37,082,939 probably null Het
Ehd4 T A 2: 120,154,348 Y43F probably damaging Het
Eno1 T C 4: 150,244,033 I90T possibly damaging Het
Epb41l1 A G 2: 156,521,557 Y662C probably benign Het
Fkbp14 A G 6: 54,589,314 L103P probably damaging Het
Gm10322 C A 10: 59,616,230 N56K probably benign Het
Iqcd C A 5: 120,602,411 T269K probably damaging Het
Kat6b T A 14: 21,618,904 C249* probably null Het
Kcnab2 T C 4: 152,404,601 R109G probably null Het
Obox7 C A 7: 14,664,106 Q24K probably damaging Het
Obox7 A G 7: 14,664,107 Q24R probably damaging Het
Olfr1537 A C 9: 39,238,079 L115* probably null Het
Olfr491 A G 7: 108,317,358 N155D probably damaging Het
Olfr493 G A 7: 108,346,558 T141I probably benign Het
Rasgrf2 C T 13: 91,890,598 G1043D probably damaging Het
Slf1 A G 13: 77,043,569 S1049P probably damaging Het
Smc1b A T 15: 85,120,647 F409I possibly damaging Het
Tab2 A G 10: 7,919,359 V453A probably damaging Het
Ubr4 A G 4: 139,393,414 Y338C probably damaging Het
Usp6nl A G 2: 6,440,976 E588G probably benign Het
Vcan T C 13: 89,725,547 R63G probably damaging Het
Zfp775 A G 6: 48,613,253 probably null Het
Zfpm2 T C 15: 41,103,544 C1010R probably damaging Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGACGAGGAAACACTCTTG -3'
(R):5'- GCGAGTAATGAGCTGGTCAG -3'

Sequencing Primer
(F):5'- CGACGAGGAAACACTCTTGAGATTTC -3'
(R):5'- GTTTAATGCGGGAGAAATCTGAAATC -3'
Posted On2015-06-10