Incidental Mutation 'R4179:Dqx1'
ID319625
Institutional Source Beutler Lab
Gene Symbol Dqx1
Ensembl Gene ENSMUSG00000009145
Gene NameDEAQ RNA-dependent ATPase
Synonyms
MMRRC Submission 041015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location83057844-83067318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83059479 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 155 (T155A)
Ref Sequence ENSEMBL: ENSMUSP00000144697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077502] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000204803]
Predicted Effect probably benign
Transcript: ENSMUST00000077502
AA Change: T155A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076708
Gene: ENSMUSG00000009145
AA Change: T155A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 5.01e-4 SMART
low complexity region 268 280 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
HA2 441 530 4e-19 SMART
Pfam:OB_NTP_bind 555 674 2.2e-11 PFAM
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203749
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204510
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect probably benign
Transcript: ENSMUST00000204803
AA Change: T155A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144697
Gene: ENSMUSG00000009145
AA Change: T155A

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 2.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp47 T C 7: 112,087,884 L683P probably damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Dqx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Dqx1 APN 6 83066427 unclassified probably benign
IGL02158:Dqx1 APN 6 83058910 splice site probably benign
IGL02288:Dqx1 APN 6 83060328 missense probably damaging 0.98
IGL02801:Dqx1 APN 6 83060495 unclassified probably null
IGL02929:Dqx1 APN 6 83060484 unclassified probably benign
R0396:Dqx1 UTSW 6 83059005 missense probably benign 0.00
R0448:Dqx1 UTSW 6 83060345 missense probably damaging 1.00
R0471:Dqx1 UTSW 6 83059426 splice site probably benign
R1022:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1023:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1024:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1480:Dqx1 UTSW 6 83059452 missense possibly damaging 0.61
R1804:Dqx1 UTSW 6 83060322 missense probably damaging 1.00
R1848:Dqx1 UTSW 6 83066107 missense probably damaging 1.00
R1982:Dqx1 UTSW 6 83058577 missense probably damaging 1.00
R2064:Dqx1 UTSW 6 83058543 unclassified probably benign
R2350:Dqx1 UTSW 6 83059087 nonsense probably null
R3110:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3112:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3119:Dqx1 UTSW 6 83066235 nonsense probably null
R4180:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4873:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4875:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4882:Dqx1 UTSW 6 83066088 critical splice acceptor site probably null
R5015:Dqx1 UTSW 6 83066111 missense probably benign 0.00
R5128:Dqx1 UTSW 6 83060567 missense probably damaging 0.96
R5346:Dqx1 UTSW 6 83059719 missense possibly damaging 0.87
R5480:Dqx1 UTSW 6 83064803 missense probably damaging 0.98
R6939:Dqx1 UTSW 6 83059465 missense probably damaging 0.99
R6979:Dqx1 UTSW 6 83061011 missense probably damaging 1.00
R7059:Dqx1 UTSW 6 83064809 missense probably benign 0.18
R7084:Dqx1 UTSW 6 83066455 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATAAACCAAGTGCTCTC -3'
(R):5'- GAATTGCCCCAGAAAGCCTG -3'

Sequencing Primer
(F):5'- GTGGGATCACACTTAATGGTCCAC -3'
(R):5'- GAAAGCCTGGAATTTTGGTTCAAGC -3'
Posted On2015-06-10