Incidental Mutation 'R4179:Usp47'
ID319632
Institutional Source Beutler Lab
Gene Symbol Usp47
Ensembl Gene ENSMUSG00000059263
Gene Nameubiquitin specific peptidase 47
SynonymsA630020C16Rik, 4930502N04Rik
MMRRC Submission 041015-MU
Accession Numbers

Genbank: NM_133758; MGI: 1922246

Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R4179 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location112023504-112111661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112087884 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 683 (L683P)
Ref Sequence ENSEMBL: ENSMUSP00000151051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106653] [ENSMUST00000210309] [ENSMUST00000215510]
Predicted Effect probably damaging
Transcript: ENSMUST00000106653
AA Change: L663P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102264
Gene: ENSMUSG00000059263
AA Change: L663P

DomainStartEndE-ValueType
Pfam:UCH 167 541 1.2e-50 PFAM
Pfam:UCH_1 168 507 5.1e-31 PFAM
coiled coil region 554 586 N/A INTRINSIC
low complexity region 859 880 N/A INTRINSIC
low complexity region 934 950 N/A INTRINSIC
Pfam:Ubiquitin_2 1026 1095 1.9e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210309
AA Change: L683P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210526
Predicted Effect probably damaging
Transcript: ENSMUST00000215510
AA Change: L683P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a gene trap allele exhibit increased sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T C 8: 43,651,091 M506V probably benign Het
Ano1 A T 7: 144,650,505 M290K probably damaging Het
Arrdc2 A T 8: 70,837,177 L34Q probably damaging Het
Cdadc1 G T 14: 59,592,486 T77N probably benign Het
Cmtr2 C G 8: 110,221,037 probably null Het
Cnot2 A T 10: 116,498,143 V374E possibly damaging Het
Crnn T C 3: 93,146,813 M1T probably null Het
Ctsb A G 14: 63,133,452 N38D probably benign Het
Dock10 A C 1: 80,510,417 S2010A probably benign Het
Dqx1 A G 6: 83,059,479 T155A probably benign Het
Dysf G A 6: 84,186,509 probably null Het
Eci1 T C 17: 24,436,277 W119R probably damaging Het
Foxo1 C A 3: 52,345,419 D334E probably benign Het
Gck T C 11: 5,910,295 T116A probably benign Het
Gcn1l1 T C 5: 115,588,050 V588A probably benign Het
Gm7168 A G 17: 13,949,003 I211V probably benign Het
Idh3g A T X: 73,782,004 probably null Het
Jag1 A G 2: 137,101,658 F206S probably damaging Het
Loxl3 G A 6: 83,037,584 V158I probably benign Het
Ly6g A G 15: 75,155,718 probably null Het
Myo1b A G 1: 51,778,526 F532L probably damaging Het
Naip1 T A 13: 100,426,176 N827I probably damaging Het
Nlrp9c G A 7: 26,384,661 H498Y possibly damaging Het
Olfr149 A G 9: 39,702,091 I226T probably benign Het
Pak2 C G 16: 32,052,187 G59A probably benign Het
Pcdha2 T A 18: 36,941,476 L720Q probably damaging Het
Pcdhb9 T A 18: 37,401,115 M54K probably benign Het
Pde2a A G 7: 101,481,383 *71W probably null Het
Pkd2l1 T C 19: 44,192,181 N32D probably benign Het
Pkhd1l1 A C 15: 44,523,649 Y1306S probably benign Het
Plec T C 15: 76,180,215 K1953R possibly damaging Het
Plekhg4 T A 8: 105,381,398 V1029E possibly damaging Het
Prkd1 C A 12: 50,366,448 G647C probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Qser1 A G 2: 104,776,384 I1510T probably benign Het
Ranbp3l T C 15: 9,057,198 I314T possibly damaging Het
Rgs9 C A 11: 109,281,448 probably null Het
Riok1 T C 13: 38,048,955 F216L probably damaging Het
Rrm1 T A 7: 102,457,198 I308N probably damaging Het
Serpina1f A T 12: 103,691,920 M242K probably benign Het
Smox G A 2: 131,524,850 M576I possibly damaging Het
Spaca7 A T 8: 12,586,435 N87I probably damaging Het
Spink5 A T 18: 43,987,867 Q296L probably benign Het
Sspo T C 6: 48,498,395 probably null Het
Sult2b1 T A 7: 45,735,311 I114F probably damaging Het
Tex12 T C 9: 50,559,287 probably null Het
Tonsl A G 15: 76,624,475 L26P probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tsen54 T C 11: 115,820,852 V365A probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wdr18 T C 10: 79,965,041 L146P probably damaging Het
Zfp709 A G 8: 71,889,906 Y392C probably damaging Het
Zranb3 A T 1: 127,960,864 I828N possibly damaging Het
Other mutations in Usp47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Usp47 APN 7 112074783 missense probably benign 0.00
IGL00574:Usp47 APN 7 112063335 missense probably damaging 1.00
IGL00975:Usp47 APN 7 112093370 missense probably damaging 1.00
IGL01289:Usp47 APN 7 112063358 missense probably damaging 1.00
IGL01419:Usp47 APN 7 112087911 missense possibly damaging 0.94
IGL01645:Usp47 APN 7 112054862 missense probably damaging 0.96
IGL01871:Usp47 APN 7 112077786 splice site probably benign
IGL02066:Usp47 APN 7 112064397 missense probably damaging 1.00
IGL02122:Usp47 APN 7 112106908 missense probably damaging 0.97
IGL02153:Usp47 APN 7 112104049 missense probably benign 0.00
IGL02550:Usp47 APN 7 112104354 missense probably damaging 1.00
IGL02710:Usp47 APN 7 112092925 missense probably benign 0.01
IGL02756:Usp47 APN 7 112093063 missense possibly damaging 0.76
IGL03093:Usp47 APN 7 112089620 missense probably damaging 1.00
IGL03398:Usp47 APN 7 112074503 missense probably damaging 1.00
0152:Usp47 UTSW 7 112056577 missense probably damaging 0.96
PIT4142001:Usp47 UTSW 7 112104341 splice site probably benign
R0110:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0381:Usp47 UTSW 7 112063393 critical splice donor site probably null
R0450:Usp47 UTSW 7 112056580 missense possibly damaging 0.88
R0634:Usp47 UTSW 7 112108655 missense probably damaging 1.00
R0881:Usp47 UTSW 7 112091436 missense possibly damaging 0.51
R1178:Usp47 UTSW 7 112109998 missense possibly damaging 0.68
R1447:Usp47 UTSW 7 112074568 critical splice donor site probably null
R1640:Usp47 UTSW 7 112083127 missense probably damaging 0.99
R1727:Usp47 UTSW 7 112086100 missense probably damaging 0.96
R1866:Usp47 UTSW 7 112101870 missense possibly damaging 0.93
R1876:Usp47 UTSW 7 112054920 missense probably damaging 0.99
R1953:Usp47 UTSW 7 112092876 missense probably benign 0.26
R2117:Usp47 UTSW 7 112067236 critical splice donor site probably null
R2176:Usp47 UTSW 7 112092727 missense probably benign 0.00
R2187:Usp47 UTSW 7 112067191 missense probably damaging 1.00
R2504:Usp47 UTSW 7 112104470 critical splice donor site probably null
R2902:Usp47 UTSW 7 112093451 missense probably damaging 1.00
R2922:Usp47 UTSW 7 112093198 missense probably damaging 1.00
R2939:Usp47 UTSW 7 112082536 missense probably damaging 1.00
R4065:Usp47 UTSW 7 112053416 missense probably benign 0.30
R4235:Usp47 UTSW 7 112110048 missense probably damaging 0.99
R4243:Usp47 UTSW 7 112108629 missense probably damaging 1.00
R4281:Usp47 UTSW 7 112109993 missense probably benign 0.03
R4360:Usp47 UTSW 7 112054932 missense probably damaging 1.00
R4604:Usp47 UTSW 7 112101831 missense probably damaging 1.00
R4857:Usp47 UTSW 7 112082552 missense probably damaging 1.00
R5133:Usp47 UTSW 7 112083882 missense probably damaging 1.00
R5179:Usp47 UTSW 7 112093432 missense probably damaging 1.00
R5322:Usp47 UTSW 7 112053269 missense probably damaging 0.99
R5445:Usp47 UTSW 7 112074721 missense probably damaging 1.00
R5465:Usp47 UTSW 7 112059002 missense probably damaging 1.00
R5699:Usp47 UTSW 7 112109997 missense probably benign 0.00
R5961:Usp47 UTSW 7 112053316 missense probably damaging 1.00
R6117:Usp47 UTSW 7 112087932 missense probably damaging 0.98
R6271:Usp47 UTSW 7 112087056 missense probably damaging 1.00
R7155:Usp47 UTSW 7 112087013 missense probably damaging 0.97
R7229:Usp47 UTSW 7 112092877 missense probably benign 0.04
R7285:Usp47 UTSW 7 112093108 missense probably benign 0.02
X0027:Usp47 UTSW 7 112087847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGACGGTCTTGGCCTCATG -3'
(R):5'- ATTAATTGCTGACTACTTCTCAACC -3'

Sequencing Primer
(F):5'- ATGGCTGCTCATACCCTGTAATAGTG -3'
(R):5'- CTGACTACTTCTCAACCTATCAAAAC -3'
Posted On2015-06-10