Incidental Mutation 'R4181:Pdss1'
ID319718
Institutional Source Beutler Lab
Gene Symbol Pdss1
Ensembl Gene ENSMUSG00000026784
Gene Nameprenyl (solanesyl) diphosphate synthase, subunit 1
Synonyms2610203G20Rik, Tprt, mSPS1, 2700031G06Rik
MMRRC Submission 041017-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4181 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22895522-22940266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22915505 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 265 (I265T)
Ref Sequence ENSEMBL: ENSMUSP00000121873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053729] [ENSMUST00000152170]
Predicted Effect probably damaging
Transcript: ENSMUST00000053729
AA Change: I265T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055689
Gene: ENSMUSG00000026784
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:polyprenyl_synt 117 366 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148072
Predicted Effect probably damaging
Transcript: ENSMUST00000152170
AA Change: I265T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121873
Gene: ENSMUSG00000026784
AA Change: I265T

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:polyprenyl_synt 114 276 6e-35 PFAM
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 92% (48/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Atp11b A G 3: 35,789,558 T185A probably damaging Het
Atp11b A G 3: 35,800,565 K284R probably benign Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Carmil3 G A 14: 55,503,955 D1066N probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Cmpk2 T C 12: 26,477,047 V345A probably damaging Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Cyp2d34 A T 15: 82,617,285 probably null Het
Cyp7a1 C T 4: 6,271,205 G317E probably benign Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Drc1 T C 5: 30,355,713 V377A probably benign Het
Fyb A G 15: 6,580,923 N326D probably benign Het
Gapdh C T 6: 125,165,234 probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Gtpbp3 C T 8: 71,491,467 T285I probably damaging Het
Hnrnpul1 T C 7: 25,726,812 D538G probably damaging Het
Kif26b G A 1: 178,915,426 S582N probably damaging Het
Lgals4 T C 7: 28,836,012 V107A possibly damaging Het
Lmbr1l A T 15: 98,908,720 L270Q possibly damaging Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lpcat3 C T 6: 124,703,224 probably benign Het
Lrp1b G A 2: 40,611,434 T219I probably damaging Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Olfr1055 A T 2: 86,347,237 H176Q probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr849 C T 9: 19,441,735 A274V possibly damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rbbp6 A G 7: 122,994,735 Y568C probably damaging Het
Rorc G A 3: 94,387,193 C33Y probably damaging Het
Ssc4d T C 5: 135,961,924 E470G possibly damaging Het
Tnxb T G 17: 34,709,454 V2614G possibly damaging Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vangl1 A T 3: 102,165,781 probably benign Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Wiz T C 17: 32,367,985 E117G probably damaging Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Pdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Pdss1 APN 2 22935577 missense possibly damaging 0.49
IGL02512:Pdss1 APN 2 22912646 missense probably damaging 1.00
IGL02691:Pdss1 APN 2 22915241 missense probably benign
LCD18:Pdss1 UTSW 2 22900968 intron probably benign
R0190:Pdss1 UTSW 2 22906831 missense probably damaging 0.97
R0576:Pdss1 UTSW 2 22915413 critical splice acceptor site probably null
R0732:Pdss1 UTSW 2 22901312 missense probably benign 0.00
R1682:Pdss1 UTSW 2 22915519 missense probably damaging 1.00
R1808:Pdss1 UTSW 2 22906834 nonsense probably null
R2430:Pdss1 UTSW 2 22929593 nonsense probably null
R2937:Pdss1 UTSW 2 22906787 splice site probably null
R2938:Pdss1 UTSW 2 22906787 splice site probably null
R4302:Pdss1 UTSW 2 22915505 missense probably damaging 1.00
R4323:Pdss1 UTSW 2 22912596 splice site probably benign
R5076:Pdss1 UTSW 2 22899917 critical splice acceptor site probably null
R5108:Pdss1 UTSW 2 22906883 missense possibly damaging 0.94
R6333:Pdss1 UTSW 2 22901766 missense probably damaging 1.00
R7138:Pdss1 UTSW 2 22912669 missense probably damaging 1.00
R7286:Pdss1 UTSW 2 22935641 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGTTGTATCTATGTTAGCCC -3'
(R):5'- ACAACAAAGTGTCTGGGACG -3'

Sequencing Primer
(F):5'- AGCCCAAGTTATTGAAGATTTGGTGC -3'
(R):5'- CTGGGACGTAATGGTTTCTCTATGAC -3'
Posted On2015-06-10