Incidental Mutation 'R4181:Gapdh'
ID319736
Institutional Source Beutler Lab
Gene Symbol Gapdh
Ensembl Gene ENSMUSG00000057666
Gene Nameglyceraldehyde-3-phosphate dehydrogenase
SynonymsGapd, Gapd
MMRRC Submission 041017-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4181 (G1)
Quality Score178
Status Validated
Chromosome6
Chromosomal Location125161715-125166467 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 125165234 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043848] [ENSMUST00000073605] [ENSMUST00000117675] [ENSMUST00000117757] [ENSMUST00000118875] [ENSMUST00000119527] [ENSMUST00000144364] [ENSMUST00000182052] [ENSMUST00000182277] [ENSMUST00000183272]
Predicted Effect probably benign
Transcript: ENSMUST00000043848
SMART Domains Protein: ENSMUSP00000042260
Gene: ENSMUSG00000038252

DomainStartEndE-ValueType
Pfam:Cnd1_N 75 240 1.4e-41 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
Pfam:Cnd1 1058 1224 2.5e-65 PFAM
low complexity region 1329 1345 N/A INTRINSIC
low complexity region 1357 1369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073605
SMART Domains Protein: ENSMUSP00000073289
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 2 143 4.2e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117675
SMART Domains Protein: ENSMUSP00000113088
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
PDB:1GK4|F 393 459 6e-7 PDB
low complexity region 474 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117757
SMART Domains Protein: ENSMUSP00000113942
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 2 150 7.33e-109 SMART
Pfam:Gp_dh_C 155 312 5.2e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118875
SMART Domains Protein: ENSMUSP00000113213
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 2 150 7.33e-109 SMART
Pfam:Gp_dh_C 155 312 7.4e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119527
SMART Domains Protein: ENSMUSP00000113376
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
PDB:1GK4|F 390 456 6e-7 PDB
low complexity region 471 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144205
Predicted Effect probably benign
Transcript: ENSMUST00000144364
SMART Domains Protein: ENSMUSP00000116701
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147954
Predicted Effect probably benign
Transcript: ENSMUST00000148835
SMART Domains Protein: ENSMUSP00000115080
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
Filament 34 348 4.99e-2 SMART
low complexity region 356 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150474
Predicted Effect probably benign
Transcript: ENSMUST00000182052
SMART Domains Protein: ENSMUSP00000138403
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 1 55 2.96e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182115
Predicted Effect probably benign
Transcript: ENSMUST00000182277
SMART Domains Protein: ENSMUSP00000138295
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 2 57 2.75e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182670
Predicted Effect probably benign
Transcript: ENSMUST00000183272
SMART Domains Protein: ENSMUSP00000138508
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 2 107 7.93e-64 SMART
Pfam:Gp_dh_C 112 269 3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192506
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 92% (48/52)
MGI Phenotype FUNCTION: This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein was originally identified as a key glycolytic enzyme that converts D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate. Subsequent studies have assigned a variety of additional functions to the protein including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Alternative splicing results in multiple transcript variants. Many pseudogenes similar to this locus are found throughout the mouse genome. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant heterozygotes show reduced enzyme levels. The currently known mutant allels are homozygous lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Atp11b A G 3: 35,789,558 T185A probably damaging Het
Atp11b A G 3: 35,800,565 K284R probably benign Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Carmil3 G A 14: 55,503,955 D1066N probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Cmpk2 T C 12: 26,477,047 V345A probably damaging Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Cyp2d34 A T 15: 82,617,285 probably null Het
Cyp7a1 C T 4: 6,271,205 G317E probably benign Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Drc1 T C 5: 30,355,713 V377A probably benign Het
Fyb A G 15: 6,580,923 N326D probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Gtpbp3 C T 8: 71,491,467 T285I probably damaging Het
Hnrnpul1 T C 7: 25,726,812 D538G probably damaging Het
Kif26b G A 1: 178,915,426 S582N probably damaging Het
Lgals4 T C 7: 28,836,012 V107A possibly damaging Het
Lmbr1l A T 15: 98,908,720 L270Q possibly damaging Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lpcat3 C T 6: 124,703,224 probably benign Het
Lrp1b G A 2: 40,611,434 T219I probably damaging Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Olfr1055 A T 2: 86,347,237 H176Q probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr849 C T 9: 19,441,735 A274V possibly damaging Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rbbp6 A G 7: 122,994,735 Y568C probably damaging Het
Rorc G A 3: 94,387,193 C33Y probably damaging Het
Ssc4d T C 5: 135,961,924 E470G possibly damaging Het
Tnxb T G 17: 34,709,454 V2614G possibly damaging Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vangl1 A T 3: 102,165,781 probably benign Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Wiz T C 17: 32,367,985 E117G probably damaging Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Gapdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Gapdh APN 6 125162507 missense probably damaging 0.99
R2203:Gapdh UTSW 6 125162606 missense probably benign 0.18
R3195:Gapdh UTSW 6 125162620 missense possibly damaging 0.94
R4480:Gapdh UTSW 6 125163182 missense possibly damaging 0.55
R5934:Gapdh UTSW 6 125162701 missense probably damaging 0.98
R6019:Gapdh UTSW 6 125163033 nonsense probably null
R6034:Gapdh UTSW 6 125165298 missense probably benign 0.25
R6212:Gapdh UTSW 6 125162698 missense probably damaging 1.00
R6776:Gapdh UTSW 6 125162273 missense probably damaging 1.00
R6928:Gapdh UTSW 6 125162671 missense probably damaging 1.00
R7188:Gapdh UTSW 6 125165440 intron probably benign
R7330:Gapdh UTSW 6 125162937 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTAATACTTAAGACTCCGGGCC -3'
(R):5'- ACTGTACGGGTCTAGGGATG -3'

Sequencing Primer
(F):5'- CGCTCATCCCCGCAAAGG -3'
(R):5'- TGCGAAGTGTGCAAGCC -3'
Posted On2015-06-10