Incidental Mutation 'R4181:Lgals4'
ID319738
Institutional Source Beutler Lab
Gene Symbol Lgals4
Ensembl Gene ENSMUSG00000053964
Gene Namelectin, galactose binding, soluble 4
Synonymsgalectin-4
MMRRC Submission 041017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4181 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28833854-28841708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28836012 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 107 (V107A)
Ref Sequence ENSEMBL: ENSMUSP00000066461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066264] [ENSMUST00000066723] [ENSMUST00000132376] [ENSMUST00000151547] [ENSMUST00000208971]
PDB Structure
Crystal structure of the N-terminal domain of mouse galectin-4 [X-RAY DIFFRACTION]
N-terminal CRD1 domain of mouse Galectin-4 in complex with lactose [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000066264
SMART Domains Protein: ENSMUSP00000066092
Gene: ENSMUSG00000053898

DomainStartEndE-ValueType
Pfam:ECH_1 61 321 7.2e-50 PFAM
Pfam:ECH_2 66 258 9.6e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000066723
AA Change: V107A

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066461
Gene: ENSMUSG00000053964
AA Change: V107A

DomainStartEndE-ValueType
GLECT 17 150 1.24e-59 SMART
Gal-bind_lectin 23 149 1.49e-59 SMART
low complexity region 151 162 N/A INTRINSIC
GLECT 196 326 1.49e-53 SMART
Gal-bind_lectin 202 326 2.02e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127093
Predicted Effect probably benign
Transcript: ENSMUST00000132376
SMART Domains Protein: ENSMUSP00000116992
Gene: ENSMUSG00000053898

DomainStartEndE-ValueType
Pfam:ECH 26 166 2.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143708
Predicted Effect possibly damaging
Transcript: ENSMUST00000151547
AA Change: V67A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141005
Gene: ENSMUSG00000053964
AA Change: V67A

DomainStartEndE-ValueType
Gal-bind_lectin 1 109 4e-45 SMART
GLECT 1 110 2.3e-38 SMART
low complexity region 111 122 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208971
AA Change: V107A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 92% (48/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The expression of this gene is restricted to small intestine, colon, and rectum, and it is underexpressed in colorectal cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Atp11b A G 3: 35,789,558 T185A probably damaging Het
Atp11b A G 3: 35,800,565 K284R probably benign Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Carmil3 G A 14: 55,503,955 D1066N probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Cmpk2 T C 12: 26,477,047 V345A probably damaging Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Cyp2d34 A T 15: 82,617,285 probably null Het
Cyp7a1 C T 4: 6,271,205 G317E probably benign Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Drc1 T C 5: 30,355,713 V377A probably benign Het
Fyb A G 15: 6,580,923 N326D probably benign Het
Gapdh C T 6: 125,165,234 probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Gtpbp3 C T 8: 71,491,467 T285I probably damaging Het
Hnrnpul1 T C 7: 25,726,812 D538G probably damaging Het
Kif26b G A 1: 178,915,426 S582N probably damaging Het
Lmbr1l A T 15: 98,908,720 L270Q possibly damaging Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lpcat3 C T 6: 124,703,224 probably benign Het
Lrp1b G A 2: 40,611,434 T219I probably damaging Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Olfr1055 A T 2: 86,347,237 H176Q probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr849 C T 9: 19,441,735 A274V possibly damaging Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rbbp6 A G 7: 122,994,735 Y568C probably damaging Het
Rorc G A 3: 94,387,193 C33Y probably damaging Het
Ssc4d T C 5: 135,961,924 E470G possibly damaging Het
Tnxb T G 17: 34,709,454 V2614G possibly damaging Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vangl1 A T 3: 102,165,781 probably benign Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Wiz T C 17: 32,367,985 E117G probably damaging Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Lgals4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Lgals4 APN 7 28841548 missense probably damaging 0.98
IGL03069:Lgals4 APN 7 28840918 missense probably benign 0.00
IGL03180:Lgals4 APN 7 28837628 missense probably damaging 1.00
R0131:Lgals4 UTSW 7 28834232 unclassified probably null
R4981:Lgals4 UTSW 7 28841276 missense probably damaging 0.98
R6199:Lgals4 UTSW 7 28835892 missense probably damaging 1.00
R6425:Lgals4 UTSW 7 28834460 nonsense probably null
R6431:Lgals4 UTSW 7 28840692
R7335:Lgals4 UTSW 7 28841146 missense probably benign 0.01
R7359:Lgals4 UTSW 7 28841299 missense probably benign 0.30
R7522:Lgals4 UTSW 7 28837692 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTCCACGTGAACTTCGCTG -3'
(R):5'- ATCTGCCCAGTATGCCCAAG -3'

Sequencing Primer
(F):5'- AACTTCGCTGTGGGGCAGG -3'
(R):5'- AAGGCTTCTGTCCACCAGG -3'
Posted On2015-06-10