Incidental Mutation 'R4181:Olfr849'
ID319743
Institutional Source Beutler Lab
Gene Symbol Olfr849
Ensembl Gene ENSMUSG00000052182
Gene Nameolfactory receptor 849
SynonymsMOR151-1, GA_x6K02T2PVTD-13176842-13177780
MMRRC Submission 041017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4181 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19440266-19446923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19441735 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 274 (A274V)
Ref Sequence ENSEMBL: ENSMUSP00000149769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063923] [ENSMUST00000217273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063923
AA Change: A274V

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064123
Gene: ENSMUSG00000052182
AA Change: A274V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 2.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157237
Predicted Effect possibly damaging
Transcript: ENSMUST00000217273
AA Change: A274V

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 92% (48/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Atp11b A G 3: 35,789,558 T185A probably damaging Het
Atp11b A G 3: 35,800,565 K284R probably benign Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Carmil3 G A 14: 55,503,955 D1066N probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Cmpk2 T C 12: 26,477,047 V345A probably damaging Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Cyp2d34 A T 15: 82,617,285 probably null Het
Cyp7a1 C T 4: 6,271,205 G317E probably benign Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Drc1 T C 5: 30,355,713 V377A probably benign Het
Fyb A G 15: 6,580,923 N326D probably benign Het
Gapdh C T 6: 125,165,234 probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Gtpbp3 C T 8: 71,491,467 T285I probably damaging Het
Hnrnpul1 T C 7: 25,726,812 D538G probably damaging Het
Kif26b G A 1: 178,915,426 S582N probably damaging Het
Lgals4 T C 7: 28,836,012 V107A possibly damaging Het
Lmbr1l A T 15: 98,908,720 L270Q possibly damaging Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lpcat3 C T 6: 124,703,224 probably benign Het
Lrp1b G A 2: 40,611,434 T219I probably damaging Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Olfr1055 A T 2: 86,347,237 H176Q probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rbbp6 A G 7: 122,994,735 Y568C probably damaging Het
Rorc G A 3: 94,387,193 C33Y probably damaging Het
Ssc4d T C 5: 135,961,924 E470G possibly damaging Het
Tnxb T G 17: 34,709,454 V2614G possibly damaging Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vangl1 A T 3: 102,165,781 probably benign Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Wiz T C 17: 32,367,985 E117G probably damaging Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Olfr849
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr849 APN 9 19440970 missense probably benign 0.01
IGL01599:Olfr849 APN 9 19441815 missense probably benign 0.00
IGL01885:Olfr849 APN 9 19441464 missense probably benign 0.01
IGL02258:Olfr849 APN 9 19440997 missense possibly damaging 0.66
IGL02258:Olfr849 APN 9 19440999 missense probably benign 0.00
IGL02282:Olfr849 APN 9 19441618 missense probably benign 0.42
R1293:Olfr849 UTSW 9 19441432 missense probably benign 0.27
R1931:Olfr849 UTSW 9 19441351 missense possibly damaging 0.93
R2444:Olfr849 UTSW 9 19441015 missense possibly damaging 0.78
R4231:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4233:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4236:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4302:Olfr849 UTSW 9 19440999 missense probably benign 0.00
R4651:Olfr849 UTSW 9 19441295 nonsense probably null
R5006:Olfr849 UTSW 9 19441249 missense probably benign 0.30
R5088:Olfr849 UTSW 9 19441771 missense probably damaging 1.00
R5501:Olfr849 UTSW 9 19440994 missense possibly damaging 0.93
R6775:Olfr849 UTSW 9 19441422 missense possibly damaging 0.56
R7038:Olfr849 UTSW 9 19441592 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCTAGTTTACACAGTGTCTGTTC -3'
(R):5'- GCTAAGCATGTTGATTCACAAAGTC -3'

Sequencing Primer
(F):5'- TCCTGTCTTTGGGATTATTTTGTC -3'
(R):5'- GCATGTTGATTCACAAAGTCTTATG -3'
Posted On2015-06-10