Incidental Mutation 'R4181:Cyp2d34'
ID319752
Institutional Source Beutler Lab
Gene Symbol Cyp2d34
Ensembl Gene ENSMUSG00000094559
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 34
Synonyms
MMRRC Submission 041017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4181 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82615965-82620946 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 82617285 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109515] [ENSMUST00000229833]
Predicted Effect probably null
Transcript: ENSMUST00000109515
SMART Domains Protein: ENSMUSP00000105141
Gene: ENSMUSG00000094559

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 3.2e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184667
Predicted Effect probably benign
Transcript: ENSMUST00000229833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231012
Meta Mutation Damage Score 0.6236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 92% (48/52)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Atp11b A G 3: 35,789,558 T185A probably damaging Het
Atp11b A G 3: 35,800,565 K284R probably benign Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Carmil3 G A 14: 55,503,955 D1066N probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Cmpk2 T C 12: 26,477,047 V345A probably damaging Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Cyp7a1 C T 4: 6,271,205 G317E probably benign Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Drc1 T C 5: 30,355,713 V377A probably benign Het
Fyb A G 15: 6,580,923 N326D probably benign Het
Gapdh C T 6: 125,165,234 probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Gtpbp3 C T 8: 71,491,467 T285I probably damaging Het
Hnrnpul1 T C 7: 25,726,812 D538G probably damaging Het
Kif26b G A 1: 178,915,426 S582N probably damaging Het
Lgals4 T C 7: 28,836,012 V107A possibly damaging Het
Lmbr1l A T 15: 98,908,720 L270Q possibly damaging Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lpcat3 C T 6: 124,703,224 probably benign Het
Lrp1b G A 2: 40,611,434 T219I probably damaging Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Olfr1055 A T 2: 86,347,237 H176Q probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr849 C T 9: 19,441,735 A274V possibly damaging Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rbbp6 A G 7: 122,994,735 Y568C probably damaging Het
Rorc G A 3: 94,387,193 C33Y probably damaging Het
Ssc4d T C 5: 135,961,924 E470G possibly damaging Het
Tnxb T G 17: 34,709,454 V2614G possibly damaging Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vangl1 A T 3: 102,165,781 probably benign Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Wiz T C 17: 32,367,985 E117G probably damaging Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Cyp2d34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Cyp2d34 APN 15 82617535 missense probably damaging 0.96
IGL00914:Cyp2d34 APN 15 82620714 missense probably damaging 0.98
IGL01347:Cyp2d34 APN 15 82616777 missense possibly damaging 0.89
IGL01354:Cyp2d34 APN 15 82617622 missense probably benign 0.00
IGL01681:Cyp2d34 APN 15 82617131 critical splice donor site probably null
IGL01733:Cyp2d34 APN 15 82618660 missense possibly damaging 0.73
IGL02231:Cyp2d34 APN 15 82618606 missense probably benign 0.44
IGL02425:Cyp2d34 APN 15 82618279 missense probably benign
IGL03219:Cyp2d34 APN 15 82618539 missense probably benign 0.01
R0684:Cyp2d34 UTSW 15 82617550 missense probably benign 0.06
R0811:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R0812:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R1617:Cyp2d34 UTSW 15 82620845 missense probably benign 0.21
R1756:Cyp2d34 UTSW 15 82617524 missense probably damaging 1.00
R1827:Cyp2d34 UTSW 15 82616094 missense probably benign 0.00
R1962:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R2102:Cyp2d34 UTSW 15 82616773 missense probably benign 0.17
R2113:Cyp2d34 UTSW 15 82617616 missense probably damaging 1.00
R2432:Cyp2d34 UTSW 15 82619011 missense probably damaging 1.00
R2566:Cyp2d34 UTSW 15 82616167 missense probably damaging 1.00
R3154:Cyp2d34 UTSW 15 82617566 missense probably benign 0.04
R3834:Cyp2d34 UTSW 15 82616746 critical splice donor site probably null
R3881:Cyp2d34 UTSW 15 82618617 missense probably benign 0.00
R4022:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R4613:Cyp2d34 UTSW 15 82616325 missense probably damaging 0.98
R4636:Cyp2d34 UTSW 15 82620728 missense probably damaging 1.00
R4695:Cyp2d34 UTSW 15 82616891 missense probably benign
R4993:Cyp2d34 UTSW 15 82618329 missense probably damaging 1.00
R5262:Cyp2d34 UTSW 15 82618371 missense probably damaging 1.00
R5402:Cyp2d34 UTSW 15 82619086 missense probably damaging 1.00
R5772:Cyp2d34 UTSW 15 82617140 missense probably null 0.24
R5874:Cyp2d34 UTSW 15 82619042 missense probably benign 0.04
R6051:Cyp2d34 UTSW 15 82616770 missense probably damaging 1.00
R6057:Cyp2d34 UTSW 15 82616351 missense probably benign
R6143:Cyp2d34 UTSW 15 82620776 missense probably benign 0.25
R6452:Cyp2d34 UTSW 15 82616089 missense probably benign 0.00
R7296:Cyp2d34 UTSW 15 82617235 missense possibly damaging 0.87
R7391:Cyp2d34 UTSW 15 82618386 missense probably benign 0.14
R7398:Cyp2d34 UTSW 15 82616763 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTCACTGGGGATTGTGCC -3'
(R):5'- ATGCCTTCCTAGCAGAGATACAG -3'

Sequencing Primer
(F):5'- CACTGGGGATTGTGCCTCTAC -3'
(R):5'- TACAGAAGGTGATTGATAGCTCC -3'
Posted On2015-06-10