Incidental Mutation 'R4181:Arhgap12'
ID319756
Institutional Source Beutler Lab
Gene Symbol Arhgap12
Ensembl Gene ENSMUSG00000041225
Gene NameRho GTPase activating protein 12
Synonyms2810011M08Rik
MMRRC Submission 041017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4181 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location6024427-6136098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6111734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 210 (D210G)
Ref Sequence ENSEMBL: ENSMUSP00000138585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062584] [ENSMUST00000077128] [ENSMUST00000182038] [ENSMUST00000182066] [ENSMUST00000182213] [ENSMUST00000182383] [ENSMUST00000182559]
Predicted Effect probably damaging
Transcript: ENSMUST00000062584
AA Change: D210G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054209
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077128
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076376
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 431 544 9.56e-11 SMART
low complexity region 546 555 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
RhoGAP 634 808 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181989
Predicted Effect probably damaging
Transcript: ENSMUST00000182038
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138150
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182066
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138496
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 409 522 9.56e-11 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
RhoGAP 612 786 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182178
Predicted Effect probably damaging
Transcript: ENSMUST00000182213
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138464
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 461 574 9.56e-11 SMART
low complexity region 576 585 N/A INTRINSIC
low complexity region 593 607 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
RhoGAP 664 838 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182383
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138444
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 309 341 5.5e0 SMART
PH 384 497 9.56e-11 SMART
low complexity region 499 508 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
RhoGAP 587 761 5.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182559
AA Change: D210G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138585
Gene: ENSMUSG00000041225
AA Change: D210G

DomainStartEndE-ValueType
SH3 13 71 1.53e-3 SMART
low complexity region 208 224 N/A INTRINSIC
WW 264 296 3.39e-6 SMART
WW 356 388 1.06e1 SMART
PH 456 569 9.56e-11 SMART
low complexity region 571 580 N/A INTRINSIC
low complexity region 588 602 N/A INTRINSIC
low complexity region 616 627 N/A INTRINSIC
RhoGAP 659 833 5.47e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182614
Predicted Effect unknown
Transcript: ENSMUST00000182921
AA Change: D82G
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 92% (48/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins that activate Rho-type guanosine triphosphate (GTP) metabolizing enzymes. The encoded protein may be involved in suppressing tumor formation by regulating cell invasion and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: A null gene trap mutation resulted in no notable phenotype in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl T C 3: 116,746,630 Y1445C probably damaging Het
Atp11b A G 3: 35,789,558 T185A probably damaging Het
Atp11b A G 3: 35,800,565 K284R probably benign Het
Bcas1 A G 2: 170,418,627 V44A probably benign Het
Carmil3 G A 14: 55,503,955 D1066N probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Clic4 A G 4: 135,226,039 V98A probably benign Het
Cmpk2 T C 12: 26,477,047 V345A probably damaging Het
Col6a3 A T 1: 90,807,614 I771N probably damaging Het
Cyp2d34 A T 15: 82,617,285 probably null Het
Cyp7a1 C T 4: 6,271,205 G317E probably benign Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Dnhd1 T A 7: 105,693,954 W1502R probably damaging Het
Drc1 T C 5: 30,355,713 V377A probably benign Het
Fyb A G 15: 6,580,923 N326D probably benign Het
Gapdh C T 6: 125,165,234 probably benign Het
Gm973 A G 1: 59,551,240 Y302C possibly damaging Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Gtpbp3 C T 8: 71,491,467 T285I probably damaging Het
Hnrnpul1 T C 7: 25,726,812 D538G probably damaging Het
Kif26b G A 1: 178,915,426 S582N probably damaging Het
Lgals4 T C 7: 28,836,012 V107A possibly damaging Het
Lmbr1l A T 15: 98,908,720 L270Q possibly damaging Het
Loxl4 T A 19: 42,607,591 Y141F probably benign Het
Lpcat3 C T 6: 124,703,224 probably benign Het
Lrp1b G A 2: 40,611,434 T219I probably damaging Het
Man2a2 T A 7: 80,351,739 E1140V possibly damaging Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Olfr1055 A T 2: 86,347,237 H176Q probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr849 C T 9: 19,441,735 A274V possibly damaging Het
Pdss1 T C 2: 22,915,505 I265T probably damaging Het
Piezo2 T C 18: 63,124,730 probably null Het
Rad50 T A 11: 53,702,005 N106I probably benign Het
Rbbp6 A G 7: 122,994,735 Y568C probably damaging Het
Rorc G A 3: 94,387,193 C33Y probably damaging Het
Ssc4d T C 5: 135,961,924 E470G possibly damaging Het
Tnxb T G 17: 34,709,454 V2614G possibly damaging Het
Trip11 A T 12: 101,893,768 D282E probably damaging Het
Ttn G T 2: 76,876,467 probably benign Het
Vangl1 A T 3: 102,165,781 probably benign Het
Wdr66 T C 5: 123,293,810 I549T probably benign Het
Wiz T C 17: 32,367,985 E117G probably damaging Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Arhgap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Arhgap12 APN 18 6057576 missense probably benign 0.01
IGL01652:Arhgap12 APN 18 6061853 missense possibly damaging 0.89
IGL01886:Arhgap12 APN 18 6027613 missense probably damaging 1.00
IGL02716:Arhgap12 APN 18 6111857 missense possibly damaging 0.95
IGL03195:Arhgap12 APN 18 6031766 missense probably damaging 1.00
IGL03134:Arhgap12 UTSW 18 6111936 missense probably benign 0.22
R0312:Arhgap12 UTSW 18 6061982 intron probably benign
R0330:Arhgap12 UTSW 18 6039382 missense probably damaging 1.00
R0600:Arhgap12 UTSW 18 6064433 intron probably benign
R0891:Arhgap12 UTSW 18 6026699 missense probably damaging 1.00
R1123:Arhgap12 UTSW 18 6031822 missense probably damaging 1.00
R1395:Arhgap12 UTSW 18 6037058 missense probably benign 0.20
R1644:Arhgap12 UTSW 18 6112340 missense probably benign 0.00
R2968:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R2970:Arhgap12 UTSW 18 6111732 missense probably damaging 1.00
R3809:Arhgap12 UTSW 18 6037057 missense probably benign 0.36
R3824:Arhgap12 UTSW 18 6061930 missense possibly damaging 0.80
R4182:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4183:Arhgap12 UTSW 18 6111734 missense probably damaging 1.00
R4497:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R4498:Arhgap12 UTSW 18 6111774 missense probably damaging 1.00
R5456:Arhgap12 UTSW 18 6112170 nonsense probably null
R5539:Arhgap12 UTSW 18 6111932 missense probably benign 0.00
R5915:Arhgap12 UTSW 18 6037016 critical splice donor site probably null
R6859:Arhgap12 UTSW 18 6111803 missense probably damaging 1.00
R6960:Arhgap12 UTSW 18 6111901 missense probably damaging 1.00
R7114:Arhgap12 UTSW 18 6028056 missense probably damaging 1.00
R7285:Arhgap12 UTSW 18 6111920 missense probably damaging 1.00
R7359:Arhgap12 UTSW 18 6065709 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGATCGACTCTGTGTGTTCC -3'
(R):5'- TTCGGATCCAATTATAATTCAGGCC -3'

Sequencing Primer
(F):5'- TGTTCCGAACACATAAAGCAAAAC -3'
(R):5'- GCCTGGACCTGACCCATAATAATG -3'
Posted On2015-06-10