Incidental Mutation 'R4183:Nat10'
ID319806
Institutional Source Beutler Lab
Gene Symbol Nat10
Ensembl Gene ENSMUSG00000027185
Gene NameN-acetyltransferase 10
Synonyms
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location103721256-103761270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103739813 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 395 (L395P)
Ref Sequence ENSEMBL: ENSMUSP00000028608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028608]
Predicted Effect probably damaging
Transcript: ENSMUST00000028608
AA Change: L395P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028608
Gene: ENSMUSG00000027185
AA Change: L395P

DomainStartEndE-ValueType
Pfam:DUF1726 107 201 6.9e-39 PFAM
low complexity region 226 242 N/A INTRINSIC
Pfam:Helicase_RecD 281 488 1.3e-68 PFAM
Pfam:GNAT_acetyltr_2 528 753 7e-103 PFAM
Pfam:tRNA_bind_2 771 892 3.6e-46 PFAM
low complexity region 999 1024 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145189
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA cytidine acetyltransferase involved in histone acetylation, tRNA acetylation, the biosynthesis of 18S rRNA, and the enhancement of nuclear architecture and chromatin organization. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Nat10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nat10 APN 2 103725764 critical splice acceptor site probably null
IGL01062:Nat10 APN 2 103743048 missense probably damaging 1.00
IGL01524:Nat10 APN 2 103757757 missense probably damaging 1.00
IGL02553:Nat10 APN 2 103752668 missense probably damaging 1.00
IGL03040:Nat10 APN 2 103757265 splice site probably benign
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0268:Nat10 UTSW 2 103727917 splice site probably benign
R0422:Nat10 UTSW 2 103726729 nonsense probably null
R0423:Nat10 UTSW 2 103748227 missense probably damaging 0.98
R0788:Nat10 UTSW 2 103743115 missense probably damaging 1.00
R0946:Nat10 UTSW 2 103731374 missense probably damaging 0.99
R1353:Nat10 UTSW 2 103754073 missense possibly damaging 0.95
R2141:Nat10 UTSW 2 103731303 splice site probably null
R2142:Nat10 UTSW 2 103731303 splice site probably null
R2192:Nat10 UTSW 2 103726177 missense probably benign 0.00
R3904:Nat10 UTSW 2 103726247 splice site probably benign
R4496:Nat10 UTSW 2 103757739 missense probably damaging 1.00
R4578:Nat10 UTSW 2 103754072 missense probably damaging 1.00
R4589:Nat10 UTSW 2 103754070 missense probably damaging 1.00
R4639:Nat10 UTSW 2 103734889 missense probably benign 0.00
R4679:Nat10 UTSW 2 103732170 missense probably damaging 1.00
R4711:Nat10 UTSW 2 103748267 nonsense probably null
R5089:Nat10 UTSW 2 103757143 unclassified probably benign
R5103:Nat10 UTSW 2 103757260 missense probably damaging 0.97
R5108:Nat10 UTSW 2 103732203 missense probably damaging 0.97
R5134:Nat10 UTSW 2 103743293 missense probably benign 0.29
R5823:Nat10 UTSW 2 103730267 missense probably damaging 1.00
R5893:Nat10 UTSW 2 103721839 unclassified probably benign
R6135:Nat10 UTSW 2 103743316 missense probably damaging 1.00
R6455:Nat10 UTSW 2 103739886 missense possibly damaging 0.69
R6592:Nat10 UTSW 2 103754150 missense probably null 1.00
R6956:Nat10 UTSW 2 103734412 missense probably benign 0.01
R7036:Nat10 UTSW 2 103754108 missense probably benign 0.00
R7063:Nat10 UTSW 2 103748077 missense probably benign 0.01
X0024:Nat10 UTSW 2 103727881 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CAAAGACTTAGTGATGCTGAACC -3'
(R):5'- TCTGGTTCCAGGTGTCCAAC -3'

Sequencing Primer
(F):5'- AACCATTTTTCGTGGCCAGG -3'
(R):5'- CATTCTTGAGCTGCCAAAAGTAG -3'
Posted On2015-06-10