Mutagenetix > Incidental Mutation

Incidental Mutation 'R4184:Pkhd1'

319848

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

MMRRC Submission

041020-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R4184 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20128003-20688288 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20279501 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 2939 (H2939L)

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000088448
AA Change: H2939L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: H2939L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

95% (55/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acte1	A	T	7: 143,447,858 (GRCm39)	K234*	probably null	Het
Ccdc178	A	G	18: 22,157,841 (GRCm39)	L539P	probably damaging	Het
Cd5	T	A	19: 10,698,638 (GRCm39)	N423I	probably damaging	Het
Ceacam20	C	T	7: 19,710,041 (GRCm39)	T355I	probably damaging	Het
Chil4	G	A	3: 106,111,043 (GRCm39)	P284S	possibly damaging	Het
Cln8	T	C	8: 14,945,030 (GRCm39)	F115L	probably benign	Het
Cpne9	T	A	6: 113,259,418 (GRCm39)		probably benign	Het
Cyp4a32	C	T	4: 115,478,720 (GRCm39)	T484I	possibly damaging	Het
Des	C	G	1: 75,339,228 (GRCm39)	A251G	probably benign	Het
Dnah3	T	C	7: 119,682,516 (GRCm39)	D270G	probably damaging	Het
Epc1	T	C	18: 6,453,578 (GRCm39)	E249G	possibly damaging	Het
Fsbp	T	A	4: 11,584,058 (GRCm39)	N252K	probably benign	Het
Gramd1a	C	A	7: 30,831,940 (GRCm39)		probably benign	Het
Grsf1	G	A	5: 88,812,015 (GRCm39)	P271S	probably benign	Het
Igsf10	C	T	3: 59,227,152 (GRCm39)	V2174M	probably damaging	Het
Kcnu1	T	C	8: 26,352,445 (GRCm39)	L204P	probably damaging	Het
Kdm7a	T	C	6: 39,125,911 (GRCm39)	E628G	probably benign	Het
Klhl36	T	C	8: 120,601,124 (GRCm39)	M381T	probably damaging	Het
Kpna3	A	T	14: 61,605,624 (GRCm39)	Y474N	probably damaging	Het
Lsm8	G	T	6: 18,849,604 (GRCm39)		probably benign	Het
Mapk8	T	C	14: 33,104,177 (GRCm39)	D413G	probably damaging	Het
Mbd2	T	A	18: 70,751,050 (GRCm39)	C362S	probably damaging	Het
Mex3b	A	G	7: 82,519,238 (GRCm39)	R518G	probably benign	Het
Mical1	T	C	10: 41,357,866 (GRCm39)		probably benign	Het
Myo18a	T	C	11: 77,748,613 (GRCm39)	S1996P	probably damaging	Het
Or11g7	A	G	14: 50,690,827 (GRCm39)	Y106C	probably damaging	Het
Or11h4b	C	G	14: 50,918,507 (GRCm39)	E195Q	probably benign	Het
Or1o2	T	G	17: 37,542,739 (GRCm39)	H174P	possibly damaging	Het
Otop2	T	A	11: 115,220,671 (GRCm39)	C504S	probably benign	Het
Pkhd1l1	C	T	15: 44,455,302 (GRCm39)	T4021I	probably benign	Het
Prr36	T	C	8: 4,263,409 (GRCm39)		probably benign	Het
Ptchd4	A	T	17: 42,813,650 (GRCm39)	Y517F	probably damaging	Het
Pth1r	A	G	9: 110,571,300 (GRCm39)	M1T	probably null	Het
Rdx	C	A	9: 51,978,680 (GRCm39)	L163M	probably damaging	Het
Reep6	A	G	10: 80,169,648 (GRCm39)	Y112C	probably damaging	Het
Rpp21	A	G	17: 36,568,611 (GRCm39)		probably benign	Het
Sacs	T	A	14: 61,451,393 (GRCm39)	C4480S	probably damaging	Het
Slc15a1	G	A	14: 121,703,574 (GRCm39)	T512I	probably benign	Het
Slc22a22	A	T	15: 57,119,962 (GRCm39)	C170*	probably null	Het
Slc26a2	C	T	18: 61,331,904 (GRCm39)	R509K	probably benign	Het
Slc4a10	A	G	2: 62,147,786 (GRCm39)		probably benign	Het
Stc1	A	T	14: 69,266,834 (GRCm39)		probably benign	Het
Tbc1d32	T	A	10: 56,100,676 (GRCm39)	T101S	probably benign	Het
Tsc2	T	C	17: 24,850,990 (GRCm39)	T23A	probably benign	Het
Vmn1r52	T	G	6: 90,156,219 (GRCm39)	F174L	probably benign	Het
Zfp972	G	A	2: 177,563,250 (GRCm39)	Q56*	probably null	Het
Zfp982	A	G	4: 147,597,150 (GRCm39)	K169R	probably benign	Het
Zfpl1	A	G	19: 6,131,170 (GRCm39)	L274P	probably damaging	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20,637,098 (GRCm39)	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20,594,294 (GRCm39)	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20,151,408 (GRCm39)	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20,641,614 (GRCm39)	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20,187,971 (GRCm39)	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20,593,482 (GRCm39)	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20,279,400 (GRCm39)	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20,604,754 (GRCm39)	splice site	probably benign
IGL01313:Pkhd1	APN	1	20,271,248 (GRCm39)	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20,593,201 (GRCm39)	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20,619,939 (GRCm39)	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20,269,683 (GRCm39)	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20,629,643 (GRCm39)	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20,187,203 (GRCm39)	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20,604,857 (GRCm39)	nonsense	probably null
IGL01790:Pkhd1	APN	1	20,628,895 (GRCm39)	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20,429,134 (GRCm39)	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20,173,459 (GRCm39)	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20,290,307 (GRCm39)	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20,268,361 (GRCm39)	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20,593,791 (GRCm39)	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20,592,971 (GRCm39)	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20,271,451 (GRCm39)	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20,447,623 (GRCm39)	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20,187,419 (GRCm39)	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20,345,839 (GRCm39)	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20,654,325 (GRCm39)	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20,279,484 (GRCm39)	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20,140,600 (GRCm39)	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20,271,007 (GRCm39)	missense	probably benign
IGL02389:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20,269,710 (GRCm39)	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20,632,642 (GRCm39)	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20,484,645 (GRCm39)	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20,592,983 (GRCm39)	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20,434,425 (GRCm39)	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20,462,389 (GRCm39)	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20,143,731 (GRCm39)	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20,380,934 (GRCm39)	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20,590,480 (GRCm39)	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20,621,126 (GRCm39)	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20,628,976 (GRCm39)	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20,290,253 (GRCm39)	splice site	probably benign
IGL02752:Pkhd1	APN	1	20,623,815 (GRCm39)	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20,431,235 (GRCm39)	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20,678,640 (GRCm39)	nonsense	probably null
IGL02960:Pkhd1	APN	1	20,447,670 (GRCm39)	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20,593,187 (GRCm39)	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20,592,923 (GRCm39)	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20,635,857 (GRCm39)	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20,268,395 (GRCm39)	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20,271,243 (GRCm39)	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20,151,524 (GRCm39)	splice site	probably benign
IGL03375:Pkhd1	APN	1	20,187,247 (GRCm39)	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20,270,894 (GRCm39)	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20,593,118 (GRCm39)	missense	possibly damaging	0.46
IGL03046:Pkhd1	UTSW	1	20,607,589 (GRCm39)	missense	possibly damaging	0.81
LCD18:Pkhd1	UTSW	1	20,681,638 (GRCm39)	intron	probably benign
P0035:Pkhd1	UTSW	1	20,187,571 (GRCm39)	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20,293,130 (GRCm39)	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20,282,174 (GRCm39)	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20,282,174 (GRCm39)	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20,271,568 (GRCm39)	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20,271,568 (GRCm39)	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20,279,470 (GRCm39)	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20,279,470 (GRCm39)	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20,593,583 (GRCm39)	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20,593,583 (GRCm39)	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20,593,956 (GRCm39)	nonsense	probably null
R0105:Pkhd1	UTSW	1	20,593,956 (GRCm39)	nonsense	probably null
R0115:Pkhd1	UTSW	1	20,420,714 (GRCm39)	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20,429,141 (GRCm39)	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20,610,624 (GRCm39)	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20,345,762 (GRCm39)	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20,620,046 (GRCm39)	splice site	probably null
R0323:Pkhd1	UTSW	1	20,345,762 (GRCm39)	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20,451,771 (GRCm39)	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20,188,012 (GRCm39)	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20,629,693 (GRCm39)	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20,380,738 (GRCm39)	splice site	probably benign
R0550:Pkhd1	UTSW	1	20,417,447 (GRCm39)	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20,309,660 (GRCm39)	nonsense	probably null
R0586:Pkhd1	UTSW	1	20,594,335 (GRCm39)	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20,271,114 (GRCm39)	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20,187,397 (GRCm39)	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20,187,698 (GRCm39)	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20,594,454 (GRCm39)	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20,268,331 (GRCm39)	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20,187,708 (GRCm39)	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20,420,745 (GRCm39)	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20,269,605 (GRCm39)	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20,271,483 (GRCm39)	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20,187,950 (GRCm39)	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20,593,053 (GRCm39)	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20,637,680 (GRCm39)	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20,604,129 (GRCm39)	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20,641,629 (GRCm39)	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20,625,447 (GRCm39)	splice site	probably benign
R1411:Pkhd1	UTSW	1	20,444,120 (GRCm39)	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20,604,782 (GRCm39)	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20,593,565 (GRCm39)	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20,593,565 (GRCm39)	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20,593,207 (GRCm39)	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20,188,004 (GRCm39)	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20,187,625 (GRCm39)	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1572:Pkhd1	UTSW	1	20,417,664 (GRCm39)	missense	probably benign	0.02
R1583:Pkhd1	UTSW	1	20,188,049 (GRCm39)	missense	probably benign
R1617:Pkhd1	UTSW	1	20,268,274 (GRCm39)	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20,593,121 (GRCm39)	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20,654,353 (GRCm39)	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20,621,064 (GRCm39)	splice site	probably benign
R1753:Pkhd1	UTSW	1	20,604,129 (GRCm39)	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20,635,935 (GRCm39)	missense	probably damaging	0.98
R1791:Pkhd1	UTSW	1	20,655,376 (GRCm39)	splice site	probably benign
R1822:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20,187,293 (GRCm39)	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20,685,491 (GRCm39)	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20,636,980 (GRCm39)	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20,151,524 (GRCm39)	splice site	probably benign
R1969:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20,187,284 (GRCm39)	missense	probably benign	0.00
R2008:Pkhd1	UTSW	1	20,269,683 (GRCm39)	missense	probably damaging	0.99
R2034:Pkhd1	UTSW	1	20,270,893 (GRCm39)	missense	probably damaging	1.00
R2061:Pkhd1	UTSW	1	20,683,036 (GRCm39)	missense	possibly damaging	0.76
R2062:Pkhd1	UTSW	1	20,271,559 (GRCm39)	missense	probably damaging	0.97
R2108:Pkhd1	UTSW	1	20,623,798 (GRCm39)	nonsense	probably null
R2142:Pkhd1	UTSW	1	20,594,119 (GRCm39)	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20,484,444 (GRCm39)	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20,623,741 (GRCm39)	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20,607,584 (GRCm39)	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20,635,863 (GRCm39)	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20,604,759 (GRCm39)	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20,271,073 (GRCm39)	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20,271,079 (GRCm39)	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20,271,389 (GRCm39)	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20,279,406 (GRCm39)	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20,579,300 (GRCm39)	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20,128,526 (GRCm39)	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20,128,526 (GRCm39)	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20,293,185 (GRCm39)	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20,174,823 (GRCm39)	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20,625,353 (GRCm39)	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20,655,879 (GRCm39)	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20,128,524 (GRCm39)	makesense	probably null
R3838:Pkhd1	UTSW	1	20,604,853 (GRCm39)	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20,628,947 (GRCm39)	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20,271,151 (GRCm39)	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20,382,362 (GRCm39)	nonsense	probably null
R3926:Pkhd1	UTSW	1	20,621,097 (GRCm39)	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20,188,031 (GRCm39)	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20,633,910 (GRCm39)	missense	probably benign	0.06
R4255:Pkhd1	UTSW	1	20,664,158 (GRCm39)	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20,128,608 (GRCm39)	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20,128,841 (GRCm39)	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20,484,516 (GRCm39)	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20,309,635 (GRCm39)	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20,593,538 (GRCm39)	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20,282,082 (GRCm39)	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20,604,943 (GRCm39)	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20,683,633 (GRCm39)	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20,271,092 (GRCm39)	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20,573,280 (GRCm39)	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20,434,391 (GRCm39)	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20,151,452 (GRCm39)	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20,594,354 (GRCm39)	missense	probably benign
R4750:Pkhd1	UTSW	1	20,594,336 (GRCm39)	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20,269,639 (GRCm39)	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20,607,625 (GRCm39)	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20,140,712 (GRCm39)	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20,279,450 (GRCm39)	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20,358,429 (GRCm39)	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20,655,935 (GRCm39)	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20,270,981 (GRCm39)	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20,655,415 (GRCm39)	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20,279,448 (GRCm39)	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20,617,565 (GRCm39)	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20,345,865 (GRCm39)	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20,604,769 (GRCm39)	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20,420,635 (GRCm39)	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20,579,300 (GRCm39)	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20,636,094 (GRCm39)	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20,520,528 (GRCm39)	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20,593,658 (GRCm39)	missense	probably damaging	0.96
R5346:Pkhd1	UTSW	1	20,462,321 (GRCm39)	missense	probably benign
R5431:Pkhd1	UTSW	1	20,188,060 (GRCm39)	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20,309,609 (GRCm39)	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20,271,380 (GRCm39)	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20,447,628 (GRCm39)	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20,151,476 (GRCm39)	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20,593,366 (GRCm39)	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20,143,750 (GRCm39)	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20,628,850 (GRCm39)	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20,188,031 (GRCm39)	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20,658,755 (GRCm39)	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20,617,685 (GRCm39)	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20,593,875 (GRCm39)	nonsense	probably null
R5760:Pkhd1	UTSW	1	20,143,778 (GRCm39)	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20,279,409 (GRCm39)	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20,128,824 (GRCm39)	missense	probably benign
R5810:Pkhd1	UTSW	1	20,270,897 (GRCm39)	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20,269,629 (GRCm39)	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20,128,902 (GRCm39)	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20,271,307 (GRCm39)	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20,451,685 (GRCm39)	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20,444,960 (GRCm39)	nonsense	probably null
R5852:Pkhd1	UTSW	1	20,447,632 (GRCm39)	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20,590,434 (GRCm39)	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20,593,994 (GRCm39)	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20,282,175 (GRCm39)	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20,655,927 (GRCm39)	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20,271,047 (GRCm39)	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20,682,929 (GRCm39)	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20,128,563 (GRCm39)	missense	probably benign
R6886:Pkhd1	UTSW	1	20,417,504 (GRCm39)	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20,593,739 (GRCm39)	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20,604,925 (GRCm39)	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20,632,675 (GRCm39)	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20,628,943 (GRCm39)	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20,593,350 (GRCm39)	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20,617,743 (GRCm39)	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20,664,177 (GRCm39)	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20,271,197 (GRCm39)	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20,309,528 (GRCm39)	missense	not run
R7436:Pkhd1	UTSW	1	20,270,925 (GRCm39)	missense	probably benign
R7473:Pkhd1	UTSW	1	20,619,980 (GRCm39)	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20,417,585 (GRCm39)	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20,271,149 (GRCm39)	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20,617,717 (GRCm39)	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20,632,639 (GRCm39)	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20,573,223 (GRCm39)	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20,382,273 (GRCm39)	missense	probably benign
R7920:Pkhd1	UTSW	1	20,345,759 (GRCm39)	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20,579,115 (GRCm39)	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20,451,662 (GRCm39)	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20,683,639 (GRCm39)	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20,593,313 (GRCm39)	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20,270,981 (GRCm39)	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20,632,682 (GRCm39)	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20,607,644 (GRCm39)	splice site	probably benign
R8485:Pkhd1	UTSW	1	20,593,257 (GRCm39)	missense	probably damaging	1.00
R8504:Pkhd1	UTSW	1	20,590,432 (GRCm39)	missense	probably benign	0.10
R8544:Pkhd1	UTSW	1	20,593,199 (GRCm39)	missense	probably damaging	1.00
R8692:Pkhd1	UTSW	1	20,462,374 (GRCm39)	missense	probably damaging	1.00
R8787:Pkhd1	UTSW	1	20,358,461 (GRCm39)	missense	probably damaging	0.99
R8853:Pkhd1	UTSW	1	20,143,679 (GRCm39)	critical splice donor site	probably null
R8907:Pkhd1	UTSW	1	20,187,785 (GRCm39)	missense	possibly damaging	0.88
R8934:Pkhd1	UTSW	1	20,462,234 (GRCm39)	critical splice donor site	probably null
R8990:Pkhd1	UTSW	1	20,417,529 (GRCm39)	missense	probably benign	0.00
R8998:Pkhd1	UTSW	1	20,434,425 (GRCm39)	missense	probably damaging	1.00
R9024:Pkhd1	UTSW	1	20,592,975 (GRCm39)	missense	probably benign	0.24
R9035:Pkhd1	UTSW	1	20,573,176 (GRCm39)	missense	probably damaging	1.00
R9092:Pkhd1	UTSW	1	20,632,586 (GRCm39)	missense	probably benign	0.00
R9238:Pkhd1	UTSW	1	20,604,799 (GRCm39)	missense	possibly damaging	0.89
R9258:Pkhd1	UTSW	1	20,444,174 (GRCm39)	missense	probably damaging	0.99
R9262:Pkhd1	UTSW	1	20,618,351 (GRCm39)	missense	probably benign	0.01
R9297:Pkhd1	UTSW	1	20,293,118 (GRCm39)	missense	probably benign	0.06
R9452:Pkhd1	UTSW	1	20,682,953 (GRCm39)	missense	possibly damaging	0.77
R9515:Pkhd1	UTSW	1	20,637,741 (GRCm39)	missense	probably damaging	1.00
R9540:Pkhd1	UTSW	1	20,269,570 (GRCm39)	missense	probably benign	0.00
R9542:Pkhd1	UTSW	1	20,188,004 (GRCm39)	missense	probably damaging	1.00
R9629:Pkhd1	UTSW	1	20,462,437 (GRCm39)	missense	possibly damaging	0.63
R9644:Pkhd1	UTSW	1	20,617,690 (GRCm39)	missense	probably benign	0.04
R9739:Pkhd1	UTSW	1	20,420,708 (GRCm39)	missense	probably damaging	1.00
R9767:Pkhd1	UTSW	1	20,484,636 (GRCm39)	missense	probably benign
R9781:Pkhd1	UTSW	1	20,187,665 (GRCm39)	missense	possibly damaging	0.95
R9803:Pkhd1	UTSW	1	20,637,073 (GRCm39)	missense	probably damaging	1.00
X0012:Pkhd1	UTSW	1	20,444,150 (GRCm39)	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20,590,450 (GRCm39)	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20,593,971 (GRCm39)	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20,593,845 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,380,818 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,188,107 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,621,243 (GRCm39)	missense	probably benign
Z1177:Pkhd1	UTSW	1	20,594,162 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTAGATAAGTGGTCCAGAATC -3'
(R):5'- CTGACATCTGTGGAGTGTGC -3'

Sequencing Primer
(F):5'- GTGGTCCAGAATCACTTAGTAGC -3'
(R):5'- CCTGGAGGAAAAGCTGGCTTTC -3'

Posted On

2015-06-10