Incidental Mutation 'R4184:Kcnu1'
ID319870
Institutional Source Beutler Lab
Gene Symbol Kcnu1
Ensembl Gene ENSMUSG00000031576
Gene Namepotassium channel, subfamily U, member 1
SynonymsKcnma3, Slo3
MMRRC Submission 041020-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4184 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25849623-25937939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25862417 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 204 (L204P)
Ref Sequence ENSEMBL: ENSMUSP00000096457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098858]
Predicted Effect probably damaging
Transcript: ENSMUST00000098858
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096457
Gene: ENSMUSG00000031576
AA Change: L204P

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Ion_trans 101 323 6.9e-21 PFAM
Pfam:Ion_trans_2 229 317 4.7e-12 PFAM
low complexity region 367 380 N/A INTRINSIC
Pfam:BK_channel_a 462 557 1.2e-28 PFAM
low complexity region 670 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210273
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel family of proteins. The encoded voltage-gated ion channel allows the outward flow of potassium ions during plasma membrane hyperpolarization in sperm. Opening of this channel may be regulated by calcium ion levels. Homozygous knockout mice that lack the related mouse gene exhibit male sterility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous male mutants are infertile with impaired sperm capacitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc178 A G 18: 22,024,784 L539P probably damaging Het
Cd5 T A 19: 10,721,274 N423I probably damaging Het
Ceacam20 C T 7: 19,976,116 T355I probably damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cln8 T C 8: 14,895,030 F115L probably benign Het
Cpne9 T A 6: 113,282,457 probably benign Het
Cyp4a32 C T 4: 115,621,523 T484I possibly damaging Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnah3 T C 7: 120,083,293 D270G probably damaging Het
Epc1 T C 18: 6,453,578 E249G possibly damaging Het
Fsbp T A 4: 11,584,058 N252K probably benign Het
Gm498 A T 7: 143,894,121 K234* probably null Het
Gramd1a C A 7: 31,132,515 probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Igsf10 C T 3: 59,319,731 V2174M probably damaging Het
Kdm7a T C 6: 39,148,977 E628G probably benign Het
Klhl36 T C 8: 119,874,385 M381T probably damaging Het
Kpna3 A T 14: 61,368,175 Y474N probably damaging Het
Lsm8 G T 6: 18,849,605 probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mbd2 T A 18: 70,617,979 C362S probably damaging Het
Mex3b A G 7: 82,870,030 R518G probably benign Het
Mical1 T C 10: 41,481,870 probably benign Het
Myo18a T C 11: 77,857,787 S1996P probably damaging Het
Olfr740 A G 14: 50,453,370 Y106C probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Otop2 T A 11: 115,329,845 C504S probably benign Het
Pkhd1 T A 1: 20,209,277 H2939L probably benign Het
Pkhd1 C T 1: 20,563,686 V542M probably benign Het
Pkhd1l1 C T 15: 44,591,906 T4021I probably benign Het
Prr36 T C 8: 4,213,409 probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pth1r A G 9: 110,742,232 M1T probably null Het
Rdx C A 9: 52,067,380 L163M probably damaging Het
Reep6 A G 10: 80,333,814 Y112C probably damaging Het
Rpp21 A G 17: 36,257,719 probably benign Het
Sacs T A 14: 61,213,944 C4480S probably damaging Het
Slc15a1 G A 14: 121,466,162 T512I probably benign Het
Slc22a22 A T 15: 57,256,566 C170* probably null Het
Slc26a2 C T 18: 61,198,832 R509K probably benign Het
Slc4a10 A G 2: 62,317,442 probably benign Het
Stc1 A T 14: 69,029,385 probably benign Het
Tbc1d32 T A 10: 56,224,580 T101S probably benign Het
Tsc2 T C 17: 24,632,016 T23A probably benign Het
Vmn1r52 T G 6: 90,179,237 F174L probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Zfpl1 A G 19: 6,081,140 L274P probably damaging Het
Other mutations in Kcnu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Kcnu1 APN 8 25897856 missense probably benign 0.00
IGL00580:Kcnu1 APN 8 25865663 missense probably benign 0.04
IGL00675:Kcnu1 APN 8 25851849 missense probably benign
IGL00928:Kcnu1 APN 8 25849735 missense probably damaging 1.00
IGL01324:Kcnu1 APN 8 25849707 missense probably benign 0.22
IGL01346:Kcnu1 APN 8 25934523 splice site probably benign
IGL01361:Kcnu1 APN 8 25886768 missense possibly damaging 0.78
IGL01651:Kcnu1 APN 8 25861095 missense probably damaging 1.00
IGL01795:Kcnu1 APN 8 25913705 missense probably damaging 1.00
IGL01800:Kcnu1 APN 8 25937500 missense probably damaging 1.00
IGL01975:Kcnu1 APN 8 25934497 missense probably benign 0.29
IGL02103:Kcnu1 APN 8 25905948 missense possibly damaging 0.83
IGL02109:Kcnu1 APN 8 25937699 missense possibly damaging 0.66
IGL02127:Kcnu1 APN 8 25892062 missense probably damaging 1.00
IGL02170:Kcnu1 APN 8 25937560 missense probably damaging 1.00
IGL02217:Kcnu1 APN 8 25858184 missense probably damaging 1.00
IGL02385:Kcnu1 APN 8 25932270 missense probably damaging 1.00
IGL02493:Kcnu1 APN 8 25937520 missense possibly damaging 0.68
IGL02883:Kcnu1 APN 8 25849827 missense probably benign
IGL02884:Kcnu1 APN 8 25921528 missense probably damaging 1.00
IGL03022:Kcnu1 APN 8 25937586 missense probably damaging 0.98
IGL03281:Kcnu1 APN 8 25892077 missense probably null 1.00
IGL03345:Kcnu1 APN 8 25881293 splice site probably benign
P0026:Kcnu1 UTSW 8 25892122 missense probably damaging 1.00
PIT4677001:Kcnu1 UTSW 8 25905993 missense probably benign
R0001:Kcnu1 UTSW 8 25859270 missense probably damaging 1.00
R0419:Kcnu1 UTSW 8 25937618 missense probably benign 0.13
R0518:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0521:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0581:Kcnu1 UTSW 8 25937501 missense probably damaging 1.00
R0840:Kcnu1 UTSW 8 25913684 start codon destroyed probably null 1.00
R1282:Kcnu1 UTSW 8 25905957 missense probably benign 0.02
R1556:Kcnu1 UTSW 8 25861191 critical splice donor site probably null
R1600:Kcnu1 UTSW 8 25849793 missense probably damaging 1.00
R2011:Kcnu1 UTSW 8 25918442 missense probably benign 0.03
R2035:Kcnu1 UTSW 8 25896693 missense probably benign 0.35
R2082:Kcnu1 UTSW 8 25921549 missense probably damaging 1.00
R2132:Kcnu1 UTSW 8 25851900 missense probably damaging 0.99
R2415:Kcnu1 UTSW 8 25910878 missense probably benign
R2513:Kcnu1 UTSW 8 25905966 missense probably benign 0.00
R3712:Kcnu1 UTSW 8 25881420 missense probably damaging 1.00
R3749:Kcnu1 UTSW 8 25886770 missense probably null 0.01
R3840:Kcnu1 UTSW 8 25885352 missense possibly damaging 0.95
R3874:Kcnu1 UTSW 8 25885317 missense probably damaging 1.00
R4576:Kcnu1 UTSW 8 25890020 missense probably benign 0.06
R4658:Kcnu1 UTSW 8 25937555 missense probably damaging 1.00
R4667:Kcnu1 UTSW 8 25910921 missense possibly damaging 0.69
R4791:Kcnu1 UTSW 8 25913752 missense probably damaging 1.00
R4940:Kcnu1 UTSW 8 25897862 splice site probably null
R5120:Kcnu1 UTSW 8 25934488 missense possibly damaging 0.79
R5314:Kcnu1 UTSW 8 25862458 missense probably damaging 0.97
R5712:Kcnu1 UTSW 8 25919650 missense probably damaging 1.00
R5807:Kcnu1 UTSW 8 25849714 missense possibly damaging 0.78
R6237:Kcnu1 UTSW 8 25932334 missense probably benign
R6260:Kcnu1 UTSW 8 25851891 missense probably damaging 1.00
R6360:Kcnu1 UTSW 8 25861180 missense possibly damaging 0.73
R6612:Kcnu1 UTSW 8 25918316 missense probably benign 0.10
R6708:Kcnu1 UTSW 8 25937711 missense probably benign
R6765:Kcnu1 UTSW 8 25913645 missense probably damaging 1.00
R6816:Kcnu1 UTSW 8 25937734 nonsense probably null
R7030:Kcnu1 UTSW 8 25918463 missense probably benign 0.00
R7208:Kcnu1 UTSW 8 25919637 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTCCCACACGTTTAAGATTG -3'
(R):5'- ACGGATGCTGATGGAGTTC -3'

Sequencing Primer
(F):5'- AACTATGGAAGTGTGTGCCC -3'
(R):5'- CTGATGGAGTTCCTGATTTTCAC -3'
Posted On2015-06-10