Incidental Mutation 'R4224:Mr1'
ID319947
Institutional Source Beutler Lab
Gene Symbol Mr1
Ensembl Gene ENSMUSG00000026471
Gene Namemajor histocompatibility complex, class I-related
SynonymsH2ls, MR1
MMRRC Submission 041044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4224 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155127277-155146814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155130719 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 294 (I294N)
Ref Sequence ENSEMBL: ENSMUSP00000027744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027744] [ENSMUST00000192410] [ENSMUST00000194612]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027744
AA Change: I294N

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027744
Gene: ENSMUSG00000026471
AA Change: I294N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 19 194 1.8e-59 PFAM
Pfam:MHC_I_3 46 193 3.9e-12 PFAM
IGc1 213 284 1.51e-12 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191773
Predicted Effect probably benign
Transcript: ENSMUST00000192410
SMART Domains Protein: ENSMUSP00000141476
Gene: ENSMUSG00000026471

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 19 87 8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194612
SMART Domains Protein: ENSMUSP00000142195
Gene: ENSMUSG00000026471

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:4NQE|C 19 44 3e-7 PDB
SCOP:d1de4a2 19 44 3e-10 SMART
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAIT (mucosal-associated invariant T-cells) lymphocytes represent a small population of T-cells primarily found in the gut. The protein encoded by this gene is an antigen-presenting molecule that presents metabolites of microbial vitamin B to MAITs. This presentation may activate the MAITs to regulate the amounts of specific types of bacteria in the gut. Several transcript variants encoding different isoforms have been found for this gene, and a pseudogene of it has been detected about 36 kbp upstream on the same chromosome. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null homozyogtes lack mucosal-associated invariant T cells that express the canonical mVa19-Ja33 rearrangement of the Tcra gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182O14Rik T C 15: 40,142,276 probably null Het
Abl2 A G 1: 156,633,847 T440A probably damaging Het
Acat2 T C 17: 12,962,885 probably benign Het
Acsbg1 C T 9: 54,616,041 R434H possibly damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp6v1a C A 16: 44,101,811 A355S probably damaging Het
Corin T C 5: 72,343,108 E391G probably damaging Het
Dnah11 T G 12: 118,130,892 S814R probably benign Het
Fam214a T A 9: 75,008,726 N209K probably damaging Het
Fer1l4 A C 2: 156,020,389 V1788G probably benign Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Ica1 T C 6: 8,659,960 K112R probably benign Het
Itpr3 T C 17: 27,107,258 V1334A probably damaging Het
Khdc3 C G 9: 73,102,871 H70D possibly damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mettl21a G T 1: 64,607,956 Y147* probably null Het
Mpp5 A G 12: 78,829,718 K479E probably damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Olfr862 T A 9: 19,883,600 Y235F probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rnf213 C T 11: 119,436,823 R1879* probably null Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Tnnt1 T C 7: 4,510,007 H92R probably damaging Het
Trim37 T A 11: 87,216,463 C907S probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Tssk3 T C 4: 129,490,599 D3G probably benign Het
Ubash3a T C 17: 31,237,928 Y521H probably damaging Het
Vmn1r73 T C 7: 11,756,579 I108T probably damaging Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Vps13b A G 15: 35,876,419 T2799A probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Znrd1as T C 17: 36,958,725 probably benign Het
Other mutations in Mr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03216:Mr1 APN 1 155129289 missense possibly damaging 0.51
R0612:Mr1 UTSW 1 155137690 missense probably damaging 1.00
R1388:Mr1 UTSW 1 155132503 missense probably damaging 0.98
R1655:Mr1 UTSW 1 155132455 missense probably benign 0.05
R2157:Mr1 UTSW 1 155146630 critical splice donor site probably null
R2437:Mr1 UTSW 1 155132531 missense probably benign 0.07
R3421:Mr1 UTSW 1 155137591 missense probably damaging 1.00
R4240:Mr1 UTSW 1 155136667 missense probably damaging 1.00
R4711:Mr1 UTSW 1 155136590 missense probably benign 0.00
R4849:Mr1 UTSW 1 155130690 missense probably benign 0.00
R5915:Mr1 UTSW 1 155136788 missense probably damaging 1.00
R6882:Mr1 UTSW 1 155132453 missense possibly damaging 0.54
R6940:Mr1 UTSW 1 155129268 makesense probably null
R7315:Mr1 UTSW 1 155129290 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCATGTGATTCTTACATGATGGTC -3'
(R):5'- CTGGGGCTACACAGAGAAAC -3'

Sequencing Primer
(F):5'- TCTGTTTCTAATTGGAACTCAAGTGG -3'
(R):5'- GGCTACACAGAGAAACCCTGTCTTAG -3'
Posted On2015-06-12