Incidental Mutation 'R4224:Ica1'
ID319956
Institutional Source Beutler Lab
Gene Symbol Ica1
Ensembl Gene ENSMUSG00000062995
Gene Nameislet cell autoantigen 1
SynonymsICA69, 69kDa
MMRRC Submission 041044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4224 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location8630527-8778488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8659960 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 112 (K112R)
Ref Sequence ENSEMBL: ENSMUSP00000116861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038403] [ENSMUST00000115518] [ENSMUST00000115519] [ENSMUST00000115520] [ENSMUST00000126430] [ENSMUST00000153390] [ENSMUST00000156695]
Predicted Effect probably benign
Transcript: ENSMUST00000038403
SMART Domains Protein: ENSMUSP00000040062
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115518
SMART Domains Protein: ENSMUSP00000111180
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115519
SMART Domains Protein: ENSMUSP00000111181
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 465 4.01e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115520
SMART Domains Protein: ENSMUSP00000111182
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126430
AA Change: K112R

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116861
Gene: ENSMUSG00000062995
AA Change: K112R

DomainStartEndE-ValueType
Arfaptin 1 83 3.3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127398
SMART Domains Protein: ENSMUSP00000118194
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Blast:Arfaptin 7 40 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153390
SMART Domains Protein: ENSMUSP00000117734
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156695
SMART Domains Protein: ENSMUSP00000138459
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Pfam:ICA69 260 301 4.1e-12 PFAM
Meta Mutation Damage Score 0.1344 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an arfaptin homology domain that is found both in the cytosol and as membrane-bound form on the Golgi complex and immature secretory granules. This protein is believed to be an autoantigen in insulin-dependent diabetes mellitus and primary Sjogren's syndrome. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in diabetes and spontaneous lethality at 4-5 months of age on a NOD background, however mice on a 129/Sv background are normal. Onset of diabetes starts 4 weeks later than wild-type NOD mice and mutants are resistant to cyclophospamide-accelerated diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182O14Rik T C 15: 40,142,276 probably null Het
Abl2 A G 1: 156,633,847 T440A probably damaging Het
Acat2 T C 17: 12,962,885 probably benign Het
Acsbg1 C T 9: 54,616,041 R434H possibly damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp6v1a C A 16: 44,101,811 A355S probably damaging Het
Corin T C 5: 72,343,108 E391G probably damaging Het
Dnah11 T G 12: 118,130,892 S814R probably benign Het
Fam214a T A 9: 75,008,726 N209K probably damaging Het
Fer1l4 A C 2: 156,020,389 V1788G probably benign Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Itpr3 T C 17: 27,107,258 V1334A probably damaging Het
Khdc3 C G 9: 73,102,871 H70D possibly damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mettl21a G T 1: 64,607,956 Y147* probably null Het
Mpp5 A G 12: 78,829,718 K479E probably damaging Het
Mr1 A T 1: 155,130,719 I294N possibly damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Olfr862 T A 9: 19,883,600 Y235F probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rnf213 C T 11: 119,436,823 R1879* probably null Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Tnnt1 T C 7: 4,510,007 H92R probably damaging Het
Trim37 T A 11: 87,216,463 C907S probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Tssk3 T C 4: 129,490,599 D3G probably benign Het
Ubash3a T C 17: 31,237,928 Y521H probably damaging Het
Vmn1r73 T C 7: 11,756,579 I108T probably damaging Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Vps13b A G 15: 35,876,419 T2799A probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Znrd1as T C 17: 36,958,725 probably benign Het
Other mutations in Ica1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ica1 APN 6 8653514 missense probably benign
IGL02248:Ica1 APN 6 8758387 utr 5 prime probably benign
IGL02547:Ica1 APN 6 8670691 splice site probably null
round_heels UTSW 6 8630799 critical splice acceptor site probably null
R0099:Ica1 UTSW 6 8749778 splice site probably benign
R0244:Ica1 UTSW 6 8653632 nonsense probably null
R0479:Ica1 UTSW 6 8754627 missense probably damaging 1.00
R0479:Ica1 UTSW 6 8754683 missense probably damaging 1.00
R0628:Ica1 UTSW 6 8644256 splice site probably benign
R0826:Ica1 UTSW 6 8667375 intron probably benign
R1186:Ica1 UTSW 6 8672326 missense probably damaging 1.00
R1384:Ica1 UTSW 6 8742262 nonsense probably null
R1957:Ica1 UTSW 6 8749736 missense possibly damaging 0.85
R2431:Ica1 UTSW 6 8658265 missense probably benign
R3722:Ica1 UTSW 6 8659021 intron probably benign
R4777:Ica1 UTSW 6 8644145 missense probably benign
R5633:Ica1 UTSW 6 8667257 missense possibly damaging 0.73
R5786:Ica1 UTSW 6 8672391 missense possibly damaging 0.50
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6053:Ica1 UTSW 6 8630783 missense probably benign 0.01
R6221:Ica1 UTSW 6 8644181 missense possibly damaging 0.82
R6794:Ica1 UTSW 6 8653659 missense probably benign 0.00
R6819:Ica1 UTSW 6 8742288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTCTCTATTCAGCTGGAGC -3'
(R):5'- TGCTGTACAGGCAGACTTTATG -3'

Sequencing Primer
(F):5'- AGCTGCCTCCTCAGGGTC -3'
(R):5'- TTGCTGGCGAACTTCACAAG -3'
Posted On2015-06-12