Incidental Mutation 'R4224:Olfr862'
ID319964
Institutional Source Beutler Lab
Gene Symbol Olfr862
Ensembl Gene ENSMUSG00000063842
Gene Nameolfactory receptor 862
SynonymsGA_x6K02T2PVTD-13624132-13623212, MOR146-1
MMRRC Submission 041044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4224 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19882417-19888004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19883600 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 235 (Y235F)
Ref Sequence ENSEMBL: ENSMUSP00000078603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073765] [ENSMUST00000079660]
Predicted Effect probably benign
Transcript: ENSMUST00000073765
AA Change: Y235F

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073437
Gene: ENSMUSG00000063842
AA Change: Y235F

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:7tm_4 31 306 3.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 282 1.3e-7 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079660
AA Change: Y235F

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078603
Gene: ENSMUSG00000063842
AA Change: Y235F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 8.3e-8 PFAM
Pfam:7tm_1 41 290 4.5e-22 PFAM
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182O14Rik T C 15: 40,142,276 probably null Het
Abl2 A G 1: 156,633,847 T440A probably damaging Het
Acat2 T C 17: 12,962,885 probably benign Het
Acsbg1 C T 9: 54,616,041 R434H possibly damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp6v1a C A 16: 44,101,811 A355S probably damaging Het
Corin T C 5: 72,343,108 E391G probably damaging Het
Dnah11 T G 12: 118,130,892 S814R probably benign Het
Fam214a T A 9: 75,008,726 N209K probably damaging Het
Fer1l4 A C 2: 156,020,389 V1788G probably benign Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Ica1 T C 6: 8,659,960 K112R probably benign Het
Itpr3 T C 17: 27,107,258 V1334A probably damaging Het
Khdc3 C G 9: 73,102,871 H70D possibly damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mettl21a G T 1: 64,607,956 Y147* probably null Het
Mpp5 A G 12: 78,829,718 K479E probably damaging Het
Mr1 A T 1: 155,130,719 I294N possibly damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rnf213 C T 11: 119,436,823 R1879* probably null Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Tnnt1 T C 7: 4,510,007 H92R probably damaging Het
Trim37 T A 11: 87,216,463 C907S probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Tssk3 T C 4: 129,490,599 D3G probably benign Het
Ubash3a T C 17: 31,237,928 Y521H probably damaging Het
Vmn1r73 T C 7: 11,756,579 I108T probably damaging Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Vps13b A G 15: 35,876,419 T2799A probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Znrd1as T C 17: 36,958,725 probably benign Het
Other mutations in Olfr862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr862 APN 9 19883548 nonsense probably null
IGL01636:Olfr862 APN 9 19884188 missense probably benign 0.14
IGL01765:Olfr862 APN 9 19883951 missense possibly damaging 0.71
IGL01967:Olfr862 APN 9 19883589 missense probably damaging 0.97
IGL03145:Olfr862 APN 9 19883439 missense possibly damaging 0.93
IGL03222:Olfr862 APN 9 19884199 nonsense probably null
R0117:Olfr862 UTSW 9 19884299 missense probably damaging 0.96
R0662:Olfr862 UTSW 9 19883952 missense probably benign 0.32
R2399:Olfr862 UTSW 9 19883924 missense probably damaging 0.98
R4572:Olfr862 UTSW 9 19883979 missense probably benign
R5607:Olfr862 UTSW 9 19883976 missense probably benign 0.16
R5741:Olfr862 UTSW 9 19883561 missense possibly damaging 0.92
R5759:Olfr862 UTSW 9 19884188 missense probably benign 0.14
R6237:Olfr862 UTSW 9 19884069 missense probably damaging 1.00
R6434:Olfr862 UTSW 9 19883845 nonsense probably null
R7075:Olfr862 UTSW 9 19884063 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCTGAAAATTTTCTGGAGGGC -3'
(R):5'- ATGGAAATCCCTCATTTCTTCTGTG -3'

Sequencing Primer
(F):5'- AAAATTTTCTGGAGGGCCTTTTTC -3'
(R):5'- GATATTCCAGAGCTTCTAAAACTTGC -3'
Posted On2015-06-12