Incidental Mutation 'R4225:Spdya'
ID320016
Institutional Source Beutler Lab
Gene Symbol Spdya
Ensembl Gene ENSMUSG00000052525
Gene Namespeedy/RINGO cell cycle regulator family, member A
Synonymsspeedy/ringo, speedy A2, 4930548B21Rik, 4921517J08Rik, speedy A1, Spdy1
MMRRC Submission 041045-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R4225 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71552061-71589533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71562524 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 105 (V105I)
Ref Sequence ENSEMBL: ENSMUSP00000125912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064420] [ENSMUST00000124001] [ENSMUST00000144142] [ENSMUST00000167641]
Predicted Effect probably benign
Transcript: ENSMUST00000064420
AA Change: V105I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000063214
Gene: ENSMUSG00000052525
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Spy1 68 198 8.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124001
AA Change: V105I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118426
Gene: ENSMUSG00000052525
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Spy1 68 198 1.5e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137830
Predicted Effect probably benign
Transcript: ENSMUST00000144142
AA Change: V105I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118994
Gene: ENSMUSG00000052525
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Spy1 68 198 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167641
AA Change: V105I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125912
Gene: ENSMUSG00000052525
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Spy1 68 198 5.1e-69 PFAM
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in impaired telomere attachment to the nuclear envelope during early meiosis, abnormal chromosome pairing and homologous synapsis, and meiotic prophase I arrest in male and female germ cells leading to infertility in both sexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,085,106 I569V possibly damaging Het
AI314180 A T 4: 58,847,027 Y512N probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Arhgef26 A G 3: 62,380,922 D471G probably benign Het
Armc4 A G 18: 7,181,732 probably null Het
Atp2a2 A G 5: 122,469,726 V240A probably benign Het
Bsn A G 9: 108,106,733 M3374T unknown Het
Ccdc66 A G 14: 27,490,779 L529P probably damaging Het
Ctif A G 18: 75,435,237 I610T probably benign Het
Eif3c C G 7: 126,566,299 probably benign Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Gba2 A T 4: 43,569,464 probably benign Het
Grin1 T C 2: 25,297,320 probably benign Het
Herc2 A G 7: 56,164,987 E2696G probably damaging Het
Itgal A T 7: 127,305,312 K319M probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrig1 T A 6: 94,622,658 I348F probably damaging Het
Mc3r G A 2: 172,249,034 V59M probably damaging Het
Msh3 T C 13: 92,285,923 K575R probably benign Het
Musk A T 4: 58,373,240 M714L probably damaging Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pkd1 T C 17: 24,593,523 I3810T possibly damaging Het
Pou2f1 T C 1: 165,911,320 I177V possibly damaging Het
Rb1 T C 14: 73,269,191 M373V possibly damaging Het
Ric1 A G 19: 29,602,731 N1311D possibly damaging Het
Scn3a A G 2: 65,536,427 Y84H probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Stpg2 G A 3: 139,215,292 R86Q probably damaging Het
Tdrd6 C T 17: 43,625,973 D1395N probably damaging Het
Vmn2r101 T A 17: 19,611,689 I649N probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Other mutations in Spdya
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Spdya APN 17 71556325 missense possibly damaging 0.51
IGL01667:Spdya APN 17 71556259 start codon destroyed probably null 1.00
IGL02103:Spdya APN 17 71578247 missense probably benign 0.15
IGL02934:Spdya APN 17 71556400 missense probably benign 0.01
IGL03220:Spdya APN 17 71578291 missense possibly damaging 0.87
R0143:Spdya UTSW 17 71558640 missense probably damaging 0.96
R0570:Spdya UTSW 17 71562590 critical splice donor site probably null
R1666:Spdya UTSW 17 71578240 missense probably damaging 1.00
R4019:Spdya UTSW 17 71556314 missense possibly damaging 0.72
R4224:Spdya UTSW 17 71562524 missense probably benign 0.07
R4663:Spdya UTSW 17 71578344 missense probably benign 0.04
R5013:Spdya UTSW 17 71562504 missense possibly damaging 0.91
R5038:Spdya UTSW 17 71588566 intron probably benign
R5583:Spdya UTSW 17 71569131 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAAGTGGATTAACTCTGGGG -3'
(R):5'- TGGCATGTAATGTAAGGCCAATG -3'

Sequencing Primer
(F):5'- GTACTCAGGTGACTGTATACAG -3'
(R):5'- TAATTTTCCCACACAAGATGGC -3'
Posted On2015-06-12