Mutagenetix > Incidental Mutation

Incidental Mutation 'R4226:Arhgef5'

320038

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor 5

Synonyms

2210412D05Rik

MMRRC Submission

041046-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4226 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43242578-43266254 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43256432 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1180 (A1180V)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: A1180V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: A1180V

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: A448V

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Meta Mutation Damage Score

0.1309

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930449I24Rik	T	A	5: 146,441,690 (GRCm39)	V279E	possibly damaging	Het
Ache	T	C	5: 137,289,152 (GRCm39)	V286A	possibly damaging	Het
Amotl1	T	C	9: 14,504,974 (GRCm39)	N115S	probably benign	Het
Aoah	A	T	13: 21,163,696 (GRCm39)	Y333F	possibly damaging	Het
Ap4m1	A	T	5: 138,171,079 (GRCm39)	R74*	probably null	Het
Birc6	T	C	17: 74,926,835 (GRCm39)		probably null	Het
Capn11	A	G	17: 45,953,392 (GRCm39)		probably null	Het
Ccdc146	T	A	5: 21,527,756 (GRCm39)	I187L	probably benign	Het
Cfh	A	T	1: 140,036,664 (GRCm39)	C360S	probably damaging	Het
Csmd1	T	C	8: 16,050,490 (GRCm39)	N2249D	probably damaging	Het
Cyb5r4	T	G	9: 86,939,282 (GRCm39)	I355S	probably damaging	Het
Dnm1l	A	T	16: 16,132,251 (GRCm39)	H653Q	possibly damaging	Het
Frmd4a	C	T	2: 4,337,889 (GRCm39)	R32C	probably benign	Het
Gm16503	C	T	4: 147,625,725 (GRCm39)	S73L	unknown	Het
Hnrnpll	A	T	17: 80,357,234 (GRCm39)		probably null	Het
Igf1r	T	A	7: 67,844,826 (GRCm39)	Y866*	probably null	Het
Lct	T	C	1: 128,231,963 (GRCm39)	M629V	probably damaging	Het
Mc1r	A	G	8: 124,134,595 (GRCm39)	N116S	possibly damaging	Het
Micu2	T	C	14: 58,169,742 (GRCm39)	K203E	possibly damaging	Het
Mybpc1	C	T	10: 88,409,387 (GRCm39)	W36*	probably null	Het
Nsd1	C	T	13: 55,408,214 (GRCm39)	T1286I	probably damaging	Het
Or2a56	A	G	6: 42,932,689 (GRCm39)	T86A	probably benign	Het
Or51l14	T	C	7: 103,100,784 (GRCm39)	M80T	probably benign	Het
Pnpla3	C	A	15: 84,063,391 (GRCm39)	N256K	probably benign	Het
Polh	A	G	17: 46,483,520 (GRCm39)	S582P	probably benign	Het
Rnaseh2a	G	A	8: 85,686,702 (GRCm39)	T149I	possibly damaging	Het
Ryr1	A	C	7: 28,761,576 (GRCm39)	Y3190*	probably null	Het
Sec31b	T	A	19: 44,520,149 (GRCm39)	M212L	probably benign	Het
Smc4	A	G	3: 68,938,800 (GRCm39)	E950G	probably benign	Het
Tlr1	A	T	5: 65,083,060 (GRCm39)	S506T	probably damaging	Het
Tmem181a	T	A	17: 6,346,061 (GRCm39)	L185H	probably damaging	Het
Tmem236	G	T	2: 14,179,437 (GRCm39)	E13*	probably null	Het
Tmprss6	C	T	15: 78,330,899 (GRCm39)	V43M	probably damaging	Het
Vegfc	A	G	8: 54,612,445 (GRCm39)	Y156C	probably damaging	Het
Vmn1r39	T	C	6: 66,781,703 (GRCm39)	H205R	possibly damaging	Het
Wnk2	C	T	13: 49,244,313 (GRCm39)	D508N	probably damaging	Het
Zan	T	C	5: 137,422,240 (GRCm39)	N2793D	unknown	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43,257,203 (GRCm39)	nonsense	probably null
IGL01341:Arhgef5	APN	6	43,260,925 (GRCm39)	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43,250,962 (GRCm39)	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43,251,538 (GRCm39)	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43,249,345 (GRCm39)	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43,252,064 (GRCm39)	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43,260,916 (GRCm39)	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43,249,869 (GRCm39)	nonsense	probably null
IGL03292:Arhgef5	APN	6	43,257,180 (GRCm39)	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43,250,934 (GRCm39)	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43,257,585 (GRCm39)	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43,242,555 (GRCm39)	splice site	probably null
R0206:Arhgef5	UTSW	6	43,250,275 (GRCm39)	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43,250,275 (GRCm39)	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43,250,275 (GRCm39)	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43,250,022 (GRCm39)	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43,250,022 (GRCm39)	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43,250,330 (GRCm39)	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43,260,846 (GRCm39)	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43,260,846 (GRCm39)	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43,251,568 (GRCm39)	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43,256,449 (GRCm39)	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43,250,337 (GRCm39)	missense	probably benign
R1663:Arhgef5	UTSW	6	43,253,899 (GRCm39)	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43,257,133 (GRCm39)	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43,252,119 (GRCm39)	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43,265,616 (GRCm39)	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43,250,022 (GRCm39)	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43,260,252 (GRCm39)	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43,251,354 (GRCm39)	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43,250,724 (GRCm39)	missense	probably benign
R4205:Arhgef5	UTSW	6	43,250,766 (GRCm39)	missense	possibly damaging	0.76
R4227:Arhgef5	UTSW	6	43,256,432 (GRCm39)	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43,256,432 (GRCm39)	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43,256,432 (GRCm39)	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43,251,027 (GRCm39)	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43,252,033 (GRCm39)	missense	probably benign
R4636:Arhgef5	UTSW	6	43,251,876 (GRCm39)	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43,260,117 (GRCm39)	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43,250,484 (GRCm39)	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43,249,762 (GRCm39)	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43,249,762 (GRCm39)	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43,250,148 (GRCm39)	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43,250,634 (GRCm39)	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43,242,614 (GRCm39)	start gained	probably benign
R5251:Arhgef5	UTSW	6	43,249,815 (GRCm39)	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43,249,273 (GRCm39)	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43,250,997 (GRCm39)	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43,252,874 (GRCm39)	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43,252,038 (GRCm39)	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43,252,068 (GRCm39)	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43,251,966 (GRCm39)	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43,251,895 (GRCm39)	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43,257,933 (GRCm39)	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43,250,232 (GRCm39)	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43,251,351 (GRCm39)	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43,252,276 (GRCm39)	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43,265,665 (GRCm39)	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43,252,142 (GRCm39)	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43,250,166 (GRCm39)	nonsense	probably null
R7358:Arhgef5	UTSW	6	43,256,507 (GRCm39)	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43,257,216 (GRCm39)	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43,257,605 (GRCm39)	nonsense	probably null
R7503:Arhgef5	UTSW	6	43,250,933 (GRCm39)	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43,251,691 (GRCm39)	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43,251,691 (GRCm39)	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43,250,728 (GRCm39)	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43,252,069 (GRCm39)	nonsense	probably null
R7950:Arhgef5	UTSW	6	43,250,859 (GRCm39)	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43,260,885 (GRCm39)	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43,252,119 (GRCm39)	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43,257,579 (GRCm39)	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43,252,933 (GRCm39)	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43,264,558 (GRCm39)	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43,260,940 (GRCm39)	missense
R9610:Arhgef5	UTSW	6	43,257,890 (GRCm39)	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43,257,890 (GRCm39)	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43,251,736 (GRCm39)	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43,250,527 (GRCm39)	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43,256,407 (GRCm39)	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43,250,635 (GRCm39)	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43,249,342 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GACTCTGGCATACTCAAATACTCC -3'
(R):5'- ATCAGCTGCAATCTCAATGGC -3'

Sequencing Primer
(F):5'- GGCATACTCAAATACTCCTTGTG -3'
(R):5'- GCTGCAATCTCAATGGCTAAGC -3'

Posted On

2015-06-12