Incidental Mutation 'R4229:Tmc3'
ID320129
Institutional Source Beutler Lab
Gene Symbol Tmc3
Ensembl Gene ENSMUSG00000038540
Gene Nametransmembrane channel-like gene family 3
Synonyms
MMRRC Submission 041048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4229 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83584927-83625614 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 83597402 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039317] [ENSMUST00000164944]
Predicted Effect probably benign
Transcript: ENSMUST00000039317
SMART Domains Protein: ENSMUSP00000046028
Gene: ENSMUSG00000038540

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 5e-42 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1071 1089 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163297
Predicted Effect probably benign
Transcript: ENSMUST00000164944
SMART Domains Protein: ENSMUSP00000130348
Gene: ENSMUSG00000038540

DomainStartEndE-ValueType
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 195 214 N/A INTRINSIC
transmembrane domain 227 246 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
transmembrane domain 362 381 N/A INTRINSIC
transmembrane domain 396 415 N/A INTRINSIC
Pfam:TMC 500 615 1.1e-45 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 1042 1060 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171397
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aadac A G 3: 60,031,813 K3E possibly damaging Het
Cdc14a A G 3: 116,293,764 S533P probably damaging Het
Dsc3 G A 18: 19,965,821 T767I probably damaging Het
Dse A T 10: 34,162,744 M221K probably damaging Het
Etfb C A 7: 43,456,560 R174S probably damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm27013 A T 6: 130,677,345 S385T possibly damaging Het
Gsap A G 5: 21,246,977 D339G probably benign Het
H2-T24 G A 17: 36,014,829 A290V probably benign Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Lipk A G 19: 34,020,287 Y56C probably damaging Het
Mrpl21 A G 19: 3,286,901 I91V probably damaging Het
Nin T C 12: 70,051,210 E492G probably damaging Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1179 T A 2: 88,402,883 Q17L possibly damaging Het
Olfr1280 A G 2: 111,316,336 I286V probably damaging Het
Olfr20 A T 11: 73,354,232 T160S probably damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Plaur T C 7: 24,466,783 V93A probably damaging Het
Ptprv C A 1: 135,126,207 noncoding transcript Het
Rabep1 A G 11: 70,908,434 T295A probably benign Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Set A G 2: 30,069,519 Y139C probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Zfp148 A G 16: 33,434,763 E41G probably benign Het
Zfp677 T C 17: 21,398,282 S534P probably damaging Het
Other mutations in Tmc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tmc3 APN 7 83603474 missense probably null 1.00
IGL01372:Tmc3 APN 7 83612538 missense probably damaging 1.00
IGL02072:Tmc3 APN 7 83615940 missense probably benign 0.00
IGL02168:Tmc3 APN 7 83619995 missense possibly damaging 0.87
IGL02344:Tmc3 APN 7 83609094 missense probably benign 0.00
IGL02421:Tmc3 APN 7 83622744 missense probably benign
IGL02604:Tmc3 APN 7 83622619 missense possibly damaging 0.85
IGL02863:Tmc3 APN 7 83622286 missense probably benign 0.04
IGL02863:Tmc3 APN 7 83622285 missense possibly damaging 0.61
IGL03058:Tmc3 APN 7 83615886 missense possibly damaging 0.91
IGL03303:Tmc3 APN 7 83590725 splice site probably benign
F5770:Tmc3 UTSW 7 83622505 missense probably benign 0.01
R0133:Tmc3 UTSW 7 83612473 missense probably damaging 1.00
R0147:Tmc3 UTSW 7 83607742 missense probably damaging 1.00
R0304:Tmc3 UTSW 7 83596139 missense probably damaging 1.00
R0320:Tmc3 UTSW 7 83607819 splice site probably benign
R0478:Tmc3 UTSW 7 83622152 missense possibly damaging 0.66
R0714:Tmc3 UTSW 7 83616761 missense possibly damaging 0.94
R1471:Tmc3 UTSW 7 83598290 missense probably damaging 1.00
R1725:Tmc3 UTSW 7 83604732 missense probably damaging 1.00
R1775:Tmc3 UTSW 7 83612532 missense probably benign 0.39
R2176:Tmc3 UTSW 7 83609308 missense probably damaging 1.00
R4001:Tmc3 UTSW 7 83620063 missense probably benign 0.01
R4635:Tmc3 UTSW 7 83585082 unclassified probably benign
R4715:Tmc3 UTSW 7 83622396 missense probably benign 0.05
R4789:Tmc3 UTSW 7 83622538 missense probably damaging 0.99
R4998:Tmc3 UTSW 7 83622321 missense probably benign 0.16
R5044:Tmc3 UTSW 7 83609118 missense probably benign 0.00
R5108:Tmc3 UTSW 7 83619948 missense probably damaging 0.97
R5119:Tmc3 UTSW 7 83615010 missense probably damaging 1.00
R5428:Tmc3 UTSW 7 83612547 missense probably damaging 1.00
R5447:Tmc3 UTSW 7 83622361 missense possibly damaging 0.63
R5767:Tmc3 UTSW 7 83599982 missense probably benign 0.43
R5801:Tmc3 UTSW 7 83622478 missense possibly damaging 0.94
R6115:Tmc3 UTSW 7 83614962 missense possibly damaging 0.47
R6193:Tmc3 UTSW 7 83603335 missense probably benign 0.26
R6436:Tmc3 UTSW 7 83598487 missense probably damaging 1.00
R6478:Tmc3 UTSW 7 83622316 missense probably benign 0.31
R6648:Tmc3 UTSW 7 83597543 missense probably damaging 1.00
R6849:Tmc3 UTSW 7 83586357 missense probably damaging 1.00
R7085:Tmc3 UTSW 7 83622145 missense possibly damaging 0.88
V7581:Tmc3 UTSW 7 83622505 missense probably benign 0.01
Z1088:Tmc3 UTSW 7 83603468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAAATGGGTACAGCACTGGG -3'
(R):5'- AGGTTATAGCACCTGCCTCTC -3'

Sequencing Primer
(F):5'- TACAGCACTGGGAAGGTTGTC -3'
(R):5'- AGGCTTTGAACCTCCCACC -3'
Posted On2015-06-12