Incidental Mutation 'R4240:Areg'
ID 320154
Institutional Source Beutler Lab
Gene Symbol Areg
Ensembl Gene ENSMUSG00000029378
Gene Name amphiregulin
Synonyms Mcub, Sdgf, AR
MMRRC Submission 041057-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4240 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 91287458-91296291 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 91291375 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 106 (N106I)
Ref Sequence ENSEMBL: ENSMUSP00000031325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031325]
AlphaFold P31955
Predicted Effect probably damaging
Transcript: ENSMUST00000031325
AA Change: N106I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031325
Gene: ENSMUSG00000029378
AA Change: N106I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF 138 175 7.41e0 SMART
transmembrane domain 193 215 N/A INTRINSIC
low complexity region 222 240 N/A INTRINSIC
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein is a ligand of the epidermal growth factor receptor (EGFR) and has been shown to play a role in immunity, inflammation, tissue repair, and lung and mammary gland development. Homozygous knockout mice for this gene exhibit impaired immune system regulation in the skin and gene expression changes characteristic of chronic liver damage. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired development of mammary gland ducts in pubescent females. Mutant ducts show retarded elongation with few terminal end buds. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,603,478 (GRCm39) P93S probably benign Het
4930488N24Rik A T 17: 14,326,049 (GRCm39) noncoding transcript Het
Ceacam3 G A 7: 16,893,949 (GRCm39) E487K possibly damaging Het
Cfap46 G T 7: 139,246,203 (GRCm39) Q387K possibly damaging Het
Cfap74 C A 4: 155,547,529 (GRCm39) H1238Q probably benign Het
Cnot6l T C 5: 96,225,221 (GRCm39) T491A probably benign Het
Cog7 C T 7: 121,524,707 (GRCm39) V696M possibly damaging Het
Col22a1 C T 15: 71,878,980 (GRCm39) G59D probably damaging Het
Ddi1 A G 9: 6,265,799 (GRCm39) M190T probably benign Het
Eno1b T A 18: 48,180,907 (GRCm39) S362T probably benign Het
Erbb2 A G 11: 98,318,869 (GRCm39) K549R probably benign Het
Fam170a A T 18: 50,414,734 (GRCm39) M127L possibly damaging Het
Gm1979 T C 5: 26,206,119 (GRCm39) T154A probably benign Het
Gm6871 G T 7: 41,195,204 (GRCm39) T511K probably damaging Het
Hsf4 A G 8: 106,001,513 (GRCm39) T378A possibly damaging Het
Irf2bpl C A 12: 86,929,691 (GRCm39) Q327H possibly damaging Het
Klk6 A G 7: 43,478,597 (GRCm39) H168R probably benign Het
Kmt2d G A 15: 98,742,452 (GRCm39) probably benign Het
Kplce T C 3: 92,775,898 (GRCm39) I262V possibly damaging Het
Lad1 T A 1: 135,755,033 (GRCm39) V103D possibly damaging Het
Mcm4 A T 16: 15,445,570 (GRCm39) Y692* probably null Het
Med15 C T 16: 17,473,358 (GRCm39) R497H probably damaging Het
Mfrp T C 9: 44,014,163 (GRCm39) V177A possibly damaging Het
Mr1 T C 1: 155,012,413 (GRCm39) E167G probably damaging Het
Myo18b A G 5: 112,951,053 (GRCm39) probably null Het
Myom2 A G 8: 15,182,895 (GRCm39) D1444G probably benign Het
Nes C A 3: 87,886,666 (GRCm39) P1598T probably damaging Het
Nlrp4d A T 7: 10,115,243 (GRCm39) H479Q noncoding transcript Het
Nphp4 A G 4: 152,640,141 (GRCm39) D1009G probably benign Het
Or13a25 A G 7: 140,247,496 (GRCm39) N99D probably benign Het
Pate10 T A 9: 35,653,449 (GRCm39) Y84* probably null Het
Phactr1 T A 13: 43,248,363 (GRCm39) N437K possibly damaging Het
Polq G T 16: 36,833,543 (GRCm39) V79F probably damaging Het
Prc1 G A 7: 79,960,964 (GRCm39) probably benign Het
Rdh7 T C 10: 127,721,671 (GRCm39) I202V probably benign Het
Rsf1 C CGGCGGCGGT 7: 97,229,142 (GRCm39) probably benign Het
Sgsm3 A G 15: 80,895,983 (GRCm39) probably benign Het
Sipa1l2 T C 8: 126,218,395 (GRCm39) E314G probably benign Het
Slc8a3 T C 12: 81,361,950 (GRCm39) K290E probably damaging Het
Tbc1d17 T C 7: 44,496,250 (GRCm39) Y84C probably damaging Het
Usp46 T G 5: 74,192,928 (GRCm39) probably benign Het
Vmn2r14 T G 5: 109,364,277 (GRCm39) probably null Het
Vmn2r8 A T 5: 108,945,369 (GRCm39) V746D probably damaging Het
Xdh A G 17: 74,202,790 (GRCm39) V1120A possibly damaging Het
Zbtb38 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 9: 96,568,155 (GRCm39) probably benign Het
Zfp791 T C 8: 85,836,295 (GRCm39) H523R probably null Het
Zfp870 A G 17: 33,104,710 (GRCm39) I53T probably benign Het
Other mutations in Areg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Areg APN 5 91,288,954 (GRCm39) missense probably damaging 0.99
IGL01929:Areg APN 5 91,292,312 (GRCm39) missense probably benign
IGL01971:Areg APN 5 91,288,870 (GRCm39) missense probably benign 0.03
IGL02250:Areg APN 5 91,288,967 (GRCm39) missense possibly damaging 0.83
R1436:Areg UTSW 5 91,287,664 (GRCm39) start gained probably benign
R1674:Areg UTSW 5 91,291,485 (GRCm39) missense probably damaging 0.96
R1699:Areg UTSW 5 91,291,357 (GRCm39) missense probably damaging 1.00
R4239:Areg UTSW 5 91,291,375 (GRCm39) missense probably damaging 1.00
R4613:Areg UTSW 5 91,291,363 (GRCm39) missense probably benign 0.34
R4738:Areg UTSW 5 91,294,583 (GRCm39) missense possibly damaging 0.91
R5040:Areg UTSW 5 91,292,198 (GRCm39) missense possibly damaging 0.94
R5305:Areg UTSW 5 91,292,308 (GRCm39) missense probably damaging 1.00
R5987:Areg UTSW 5 91,294,577 (GRCm39) missense possibly damaging 0.83
R6075:Areg UTSW 5 91,291,456 (GRCm39) missense probably damaging 0.99
R7210:Areg UTSW 5 91,288,764 (GRCm39) nonsense probably null
R8165:Areg UTSW 5 91,291,492 (GRCm39) missense probably damaging 0.97
R9054:Areg UTSW 5 91,292,217 (GRCm39) missense probably damaging 1.00
R9498:Areg UTSW 5 91,294,553 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGTGCACTGCCCGATAG -3'
(R):5'- GGAAACAAACCTACTTGCATGTC -3'

Sequencing Primer
(F):5'- CCCGATAGAGCTATTCTGTGCAG -3'
(R):5'- TGCATGTCACCACCTCCAGG -3'
Posted On 2015-06-12