Incidental Mutation 'R4240:Myo18b'
ID320158
Institutional Source Beutler Lab
Gene Symbol Myo18b
Ensembl Gene ENSMUSG00000072720
Gene Namemyosin XVIIIb
Synonyms4932408L24Rik, 4933411E19Rik
MMRRC Submission 041057-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4240 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location112688876-112896362 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 112803187 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086617]
Predicted Effect probably null
Transcript: ENSMUST00000086617
SMART Domains Protein: ENSMUSP00000083810
Gene: ENSMUSG00000072720

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 377 419 N/A INTRINSIC
MYSc 605 1374 8.78e-30 SMART
IQ 1375 1397 5.92e-4 SMART
Pfam:Myosin_tail_1 1423 1875 5e-12 PFAM
low complexity region 1965 1985 N/A INTRINSIC
coiled coil region 2052 2126 N/A INTRINSIC
low complexity region 2184 2199 N/A INTRINSIC
low complexity region 2325 2336 N/A INTRINSIC
low complexity region 2408 2424 N/A INTRINSIC
low complexity region 2544 2558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183029
Meta Mutation Damage Score 0.552 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with internal hemorrhage, pericaridal effusion, enlargement of the right atrium, and cardiac myofibril abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,591 I262V possibly damaging Het
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930488N24Rik A T 17: 14,105,787 noncoding transcript Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Ceacam3 G A 7: 17,160,024 E487K possibly damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cnot6l T C 5: 96,077,362 T491A probably benign Het
Cog7 C T 7: 121,925,484 V696M possibly damaging Het
Col22a1 C T 15: 72,007,131 G59D probably damaging Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Eno1b T A 18: 48,047,840 S362T probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam170a A T 18: 50,281,667 M127L possibly damaging Het
Gm17677 T A 9: 35,742,153 Y84* probably null Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Hsf4 A G 8: 105,274,881 T378A possibly damaging Het
Irf2bpl C A 12: 86,882,917 Q327H possibly damaging Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Kmt2d G A 15: 98,844,571 probably benign Het
Lad1 T A 1: 135,827,295 V103D possibly damaging Het
Mcm4 A T 16: 15,627,706 Y692* probably null Het
Med15 C T 16: 17,655,494 R497H probably damaging Het
Mfrp T C 9: 44,102,866 V177A possibly damaging Het
Mr1 T C 1: 155,136,667 E167G probably damaging Het
Myom2 A G 8: 15,132,895 D1444G probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Nlrp4d A T 7: 10,381,316 H479Q noncoding transcript Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Rdh7 T C 10: 127,885,802 I202V probably benign Het
Rsf1 C CGGCGGCGGT 7: 97,579,935 probably benign Het
Sgsm3 A G 15: 81,011,782 probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc8a3 T C 12: 81,315,176 K290E probably damaging Het
Tbc1d17 T C 7: 44,846,826 Y84C probably damaging Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Vmn2r8 A T 5: 108,797,503 V746D probably damaging Het
Xdh A G 17: 73,895,795 V1120A possibly damaging Het
Zbtb38 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 9: 96,686,102 probably benign Het
Zfp791 T C 8: 85,109,666 H523R probably null Het
Zfp870 A G 17: 32,885,736 I53T probably benign Het
Other mutations in Myo18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Myo18b APN 5 112874131 missense probably benign 0.05
IGL00847:Myo18b APN 5 112830389 splice site probably benign
IGL00848:Myo18b APN 5 112871485 missense probably damaging 1.00
IGL00969:Myo18b APN 5 112875007 unclassified probably benign
IGL01018:Myo18b APN 5 112809747 missense probably damaging 1.00
IGL01448:Myo18b APN 5 112811704 missense probably damaging 1.00
IGL01490:Myo18b APN 5 112809700 missense possibly damaging 0.84
IGL01556:Myo18b APN 5 112757449 splice site probably benign
IGL01637:Myo18b APN 5 112840629 missense possibly damaging 0.82
IGL01819:Myo18b APN 5 112878050 missense unknown
IGL02007:Myo18b APN 5 112874972 unclassified probably benign
IGL02146:Myo18b APN 5 112843285 missense probably damaging 1.00
IGL02229:Myo18b APN 5 112878110 missense unknown
IGL02319:Myo18b APN 5 112791139 missense probably damaging 0.99
IGL02398:Myo18b APN 5 112830312 missense possibly damaging 0.92
IGL02420:Myo18b APN 5 112827986 missense possibly damaging 0.64
IGL02626:Myo18b APN 5 112878085 missense unknown
IGL02815:Myo18b APN 5 112809735 missense probably damaging 1.00
IGL02822:Myo18b APN 5 112775345 missense probably damaging 1.00
IGL02852:Myo18b APN 5 112715511 missense probably benign 0.03
IGL02995:Myo18b APN 5 112775413 splice site probably benign
IGL03019:Myo18b APN 5 112692397 missense probably benign 0.21
IGL03039:Myo18b APN 5 112840771 missense probably damaging 1.00
IGL03112:Myo18b APN 5 112873990 missense probably benign 0.02
IGL03123:Myo18b APN 5 112874938 unclassified probably benign
IGL03288:Myo18b APN 5 112789997 missense probably damaging 1.00
IGL03391:Myo18b APN 5 112874479 unclassified probably benign
PIT4651001:Myo18b UTSW 5 112834435 missense probably benign 0.01
R0271:Myo18b UTSW 5 112809685 missense possibly damaging 0.91
R0277:Myo18b UTSW 5 112693347 splice site probably benign
R0352:Myo18b UTSW 5 112874523 unclassified probably benign
R0504:Myo18b UTSW 5 112873576 unclassified probably benign
R0539:Myo18b UTSW 5 112723868 missense probably damaging 0.99
R0599:Myo18b UTSW 5 112865750 missense probably damaging 1.00
R0627:Myo18b UTSW 5 112798834 missense probably benign 0.38
R0659:Myo18b UTSW 5 112760327 missense possibly damaging 0.66
R0671:Myo18b UTSW 5 112692766 missense probably benign 0.00
R0847:Myo18b UTSW 5 112874488 unclassified probably benign
R1082:Myo18b UTSW 5 112760414 missense probably damaging 1.00
R1116:Myo18b UTSW 5 112803279 missense probably damaging 1.00
R1264:Myo18b UTSW 5 112830319 missense probably benign 0.12
R1280:Myo18b UTSW 5 112723805 critical splice donor site probably null
R1444:Myo18b UTSW 5 112775251 critical splice donor site probably null
R1446:Myo18b UTSW 5 112757559 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1590:Myo18b UTSW 5 112875266 nonsense probably null
R1601:Myo18b UTSW 5 112871498 missense possibly damaging 0.73
R1903:Myo18b UTSW 5 112692758 missense probably damaging 1.00
R1935:Myo18b UTSW 5 112760356 missense probably benign 0.04
R1936:Myo18b UTSW 5 112760356 missense probably benign 0.04
R2008:Myo18b UTSW 5 112873557 missense probably benign
R2127:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2129:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2141:Myo18b UTSW 5 112874026 missense probably benign 0.01
R2170:Myo18b UTSW 5 112723858 missense probably benign 0.23
R2258:Myo18b UTSW 5 112874663 unclassified probably benign
R2265:Myo18b UTSW 5 112782673 missense probably damaging 1.00
R2483:Myo18b UTSW 5 112858408 missense probably damaging 1.00
R2931:Myo18b UTSW 5 112693127 missense probably benign 0.01
R3160:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3162:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3777:Myo18b UTSW 5 112757596 missense probably damaging 0.99
R4243:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4245:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4533:Myo18b UTSW 5 112693025 missense probably damaging 1.00
R4631:Myo18b UTSW 5 112846400 missense probably damaging 1.00
R4661:Myo18b UTSW 5 112875175 unclassified probably benign
R4755:Myo18b UTSW 5 112874474 nonsense probably null
R4771:Myo18b UTSW 5 112692227 nonsense probably null
R4812:Myo18b UTSW 5 112809718 missense possibly damaging 0.95
R4840:Myo18b UTSW 5 112874029 missense probably benign 0.02
R4888:Myo18b UTSW 5 112874480 unclassified probably benign
R4995:Myo18b UTSW 5 112760392 missense probably damaging 0.99
R5001:Myo18b UTSW 5 112761340 missense probably damaging 0.99
R5015:Myo18b UTSW 5 112790057 missense probably damaging 1.00
R5055:Myo18b UTSW 5 112875217 unclassified probably benign
R5070:Myo18b UTSW 5 112761346 missense probably damaging 1.00
R5105:Myo18b UTSW 5 112840778 missense probably damaging 1.00
R5121:Myo18b UTSW 5 112874480 unclassified probably benign
R5130:Myo18b UTSW 5 112873903 missense probably benign 0.06
R5186:Myo18b UTSW 5 112871470 missense probably damaging 1.00
R5437:Myo18b UTSW 5 112757573 missense possibly damaging 0.73
R5535:Myo18b UTSW 5 112790042 missense probably damaging 1.00
R5560:Myo18b UTSW 5 112868295 missense probably damaging 0.96
R5810:Myo18b UTSW 5 112834450 missense probably damaging 1.00
R5898:Myo18b UTSW 5 112802330 intron probably null
R6065:Myo18b UTSW 5 112692781 missense probably benign 0.00
R6104:Myo18b UTSW 5 112874291 unclassified probably benign
R6113:Myo18b UTSW 5 112866385 missense probably damaging 1.00
R6158:Myo18b UTSW 5 112874172 missense probably benign 0.01
R6167:Myo18b UTSW 5 112872507 splice site probably null
R6220:Myo18b UTSW 5 112757507 missense possibly damaging 0.93
R6276:Myo18b UTSW 5 112811642 missense probably benign 0.31
R6290:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6291:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6795:Myo18b UTSW 5 112846364 missense probably damaging 0.99
R6798:Myo18b UTSW 5 112761386 missense probably damaging 0.98
R6817:Myo18b UTSW 5 112830238 missense probably benign 0.00
R6937:Myo18b UTSW 5 112802392 missense probably benign 0.12
R7034:Myo18b UTSW 5 112723904 nonsense probably null
R7097:Myo18b UTSW 5 112874405 missense unknown
R7145:Myo18b UTSW 5 112817679 nonsense probably null
R7201:Myo18b UTSW 5 112715459 missense probably damaging 1.00
R7260:Myo18b UTSW 5 112775288 missense probably benign 0.01
R7265:Myo18b UTSW 5 112812072 missense probably damaging 1.00
Z1088:Myo18b UTSW 5 112692943 missense possibly damaging 0.89
Z1088:Myo18b UTSW 5 112757484 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCATGAGCCTGCTATGCATATC -3'
(R):5'- ATGGTCCTACTGTGTGCAGC -3'

Sequencing Primer
(F):5'- ATGAGCCTGCTATGCATATCATGTC -3'
(R):5'- CCTACTGTGTGCAGCGTGTAG -3'
Posted On2015-06-12