Incidental Mutation 'R4240:4930488N24Rik'
ID320192
Institutional Source Beutler Lab
Gene Symbol 4930488N24Rik
Ensembl Gene ENSMUSG00000099476
Gene NameRIKEN cDNA 4930488N24 gene
Synonyms
MMRRC Submission 041057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4240 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14104924-14106450 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to T at 14105787 bp
ZygosityHeterozygous
Amino Acid Change
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188802
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 93% (50/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,591 I262V possibly damaging Het
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Ceacam3 G A 7: 17,160,024 E487K possibly damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cnot6l T C 5: 96,077,362 T491A probably benign Het
Cog7 C T 7: 121,925,484 V696M possibly damaging Het
Col22a1 C T 15: 72,007,131 G59D probably damaging Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Eno1b T A 18: 48,047,840 S362T probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam170a A T 18: 50,281,667 M127L possibly damaging Het
Gm17677 T A 9: 35,742,153 Y84* probably null Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Hsf4 A G 8: 105,274,881 T378A possibly damaging Het
Irf2bpl C A 12: 86,882,917 Q327H possibly damaging Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Kmt2d G A 15: 98,844,571 probably benign Het
Lad1 T A 1: 135,827,295 V103D possibly damaging Het
Mcm4 A T 16: 15,627,706 Y692* probably null Het
Med15 C T 16: 17,655,494 R497H probably damaging Het
Mfrp T C 9: 44,102,866 V177A possibly damaging Het
Mr1 T C 1: 155,136,667 E167G probably damaging Het
Myo18b A G 5: 112,803,187 probably null Het
Myom2 A G 8: 15,132,895 D1444G probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Nlrp4d A T 7: 10,381,316 H479Q noncoding transcript Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Rdh7 T C 10: 127,885,802 I202V probably benign Het
Rsf1 C CGGCGGCGGT 7: 97,579,935 probably benign Het
Sgsm3 A G 15: 81,011,782 probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc8a3 T C 12: 81,315,176 K290E probably damaging Het
Tbc1d17 T C 7: 44,846,826 Y84C probably damaging Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Vmn2r8 A T 5: 108,797,503 V746D probably damaging Het
Xdh A G 17: 73,895,795 V1120A possibly damaging Het
Zbtb38 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 9: 96,686,102 probably benign Het
Zfp791 T C 8: 85,109,666 H523R probably null Het
Zfp870 A G 17: 32,885,736 I53T probably benign Het
Other mutations in 4930488N24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4820:4930488N24Rik UTSW 17 14106219 exon noncoding transcript
R4902:4930488N24Rik UTSW 17 14106146 exon noncoding transcript
R5945:4930488N24Rik UTSW 17 14106339 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCAGGATCTGGTCTGACAGG -3'
(R):5'- GACTTTGGGCTTAGTACCCAAGTC -3'

Sequencing Primer
(F):5'- TCTGGTCTGACAGGGAACG -3'
(R):5'- CCAAGTCAAACCCGGAGATTTGTTG -3'
Posted On2015-06-12