Incidental Mutation 'R4241:Ubr1'
ID 320201
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Name ubiquitin protein ligase E3 component n-recognin 1
Synonyms E3 alpha
MMRRC Submission 041058-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.826) question?
Stock # R4241 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 120690750-120801196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120764867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 529 (D529G)
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
AlphaFold O70481
Predicted Effect possibly damaging
Transcript: ENSMUST00000028728
AA Change: D529G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: D529G

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154023
Meta Mutation Damage Score 0.4761 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A T 3: 116,548,497 (GRCm39) probably benign Het
Ap5b1 C T 19: 5,618,825 (GRCm39) L82F possibly damaging Het
Arfgef3 A G 10: 18,500,912 (GRCm39) S1113P probably damaging Het
Atoh1 A C 6: 64,706,758 (GRCm39) N151T probably damaging Het
Bcas3 T A 11: 85,361,652 (GRCm39) S25R probably damaging Het
Blcap T A 2: 157,402,343 (GRCm39) probably benign Het
Btbd6 C T 12: 112,940,416 (GRCm39) A13V probably benign Het
Ccdc83 A C 7: 89,896,346 (GRCm39) N74K probably damaging Het
Cdh9 A G 15: 16,849,165 (GRCm39) probably null Het
Chd1 C T 17: 15,990,289 (GRCm39) R1614* probably null Het
Col16a1 G T 4: 129,992,843 (GRCm39) Q1567H probably damaging Het
Coq6 A T 12: 84,420,563 (GRCm39) probably benign Het
Cpd T C 11: 76,737,611 (GRCm39) D61G probably benign Het
Csnk1e A G 15: 79,309,095 (GRCm39) F277S probably damaging Het
Cyp2d41-ps T A 15: 82,663,787 (GRCm39) noncoding transcript Het
Dbt T C 3: 116,326,945 (GRCm39) I98T probably damaging Het
Eif3e G A 15: 43,126,086 (GRCm39) T287I probably damaging Het
Fcgbpl1 A G 7: 27,853,760 (GRCm39) S1575G probably damaging Het
Gm7135 A G 1: 97,281,678 (GRCm39) noncoding transcript Het
Gpr176 A T 2: 118,110,091 (GRCm39) S389R probably benign Het
Hax1 A G 3: 89,902,997 (GRCm39) S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,355,630 (GRCm39) probably null Het
Ighv1-53 C T 12: 115,122,442 (GRCm39) C5Y probably benign Het
Klhl13 T A X: 23,181,414 (GRCm39) D2V probably damaging Het
Kynu A T 2: 43,571,422 (GRCm39) H446L probably benign Het
Lingo1 A G 9: 56,527,386 (GRCm39) F401S probably damaging Het
Lmbrd1 C T 1: 24,732,049 (GRCm39) Q89* probably null Het
Mov10 T A 3: 104,704,592 (GRCm39) Q773L probably benign Het
Or52e19 G T 7: 102,959,868 (GRCm39) *313Y probably null Het
Or7c70 T A 10: 78,683,739 (GRCm39) R3S probably benign Het
Pde6c G A 19: 38,151,293 (GRCm39) G608S probably damaging Het
Peli3 T C 19: 4,982,426 (GRCm39) H413R probably damaging Het
Pkdrej C T 15: 85,702,345 (GRCm39) R1197Q probably damaging Het
Rcan2 T A 17: 44,264,370 (GRCm39) V10D probably benign Het
Slc10a5 A G 3: 10,400,520 (GRCm39) S47P probably damaging Het
Sprr3 A G 3: 92,364,214 (GRCm39) V210A possibly damaging Het
Tcerg1l G T 7: 137,999,361 (GRCm39) Q8K unknown Het
Ubfd1 T C 7: 121,670,977 (GRCm39) V265A possibly damaging Het
Vmn1r180 A T 7: 23,652,298 (GRCm39) I154F probably damaging Het
Vmn1r237 A G 17: 21,534,925 (GRCm39) H216R possibly damaging Het
Whrn C T 4: 63,351,210 (GRCm39) probably benign Het
Zfr T G 15: 12,149,745 (GRCm39) D388E probably damaging Het
Zic5 T C 14: 122,702,075 (GRCm39) I219V probably benign Het
Zmat5 A G 11: 4,678,614 (GRCm39) N53D probably benign Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120,705,888 (GRCm39) missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120,771,574 (GRCm39) missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120,761,353 (GRCm39) missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120,745,386 (GRCm39) missense probably benign
IGL01346:Ubr1 APN 2 120,703,603 (GRCm39) critical splice donor site probably null
IGL01368:Ubr1 APN 2 120,771,612 (GRCm39) splice site probably benign
IGL01539:Ubr1 APN 2 120,756,494 (GRCm39) missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120,764,823 (GRCm39) missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120,705,879 (GRCm39) missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120,751,867 (GRCm39) missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120,730,989 (GRCm39) missense probably benign 0.00
IGL02208:Ubr1 APN 2 120,776,830 (GRCm39) missense probably benign 0.00
IGL02415:Ubr1 APN 2 120,801,084 (GRCm39) utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120,694,854 (GRCm39) missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120,701,460 (GRCm39) splice site probably benign
IGL02627:Ubr1 APN 2 120,771,472 (GRCm39) missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120,745,364 (GRCm39) missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120,771,572 (GRCm39) missense probably benign 0.01
IGL02939:Ubr1 APN 2 120,711,664 (GRCm39) critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120,791,637 (GRCm39) missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120,694,898 (GRCm39) missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120,725,641 (GRCm39) missense probably benign
I1329:Ubr1 UTSW 2 120,764,775 (GRCm39) splice site probably benign
R0022:Ubr1 UTSW 2 120,791,654 (GRCm39) splice site probably benign
R0345:Ubr1 UTSW 2 120,734,584 (GRCm39) splice site probably null
R0373:Ubr1 UTSW 2 120,777,138 (GRCm39) missense probably benign 0.01
R0393:Ubr1 UTSW 2 120,737,427 (GRCm39) missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120,711,574 (GRCm39) missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120,778,364 (GRCm39) nonsense probably null
R0723:Ubr1 UTSW 2 120,711,582 (GRCm39) nonsense probably null
R1178:Ubr1 UTSW 2 120,756,510 (GRCm39) nonsense probably null
R1401:Ubr1 UTSW 2 120,786,125 (GRCm39) missense probably benign 0.01
R1485:Ubr1 UTSW 2 120,791,579 (GRCm39) missense probably benign 0.03
R1572:Ubr1 UTSW 2 120,765,800 (GRCm39) splice site probably benign
R1920:Ubr1 UTSW 2 120,761,449 (GRCm39) missense probably benign 0.11
R1921:Ubr1 UTSW 2 120,761,449 (GRCm39) missense probably benign 0.11
R1997:Ubr1 UTSW 2 120,776,754 (GRCm39) critical splice donor site probably null
R2129:Ubr1 UTSW 2 120,773,034 (GRCm39) missense probably benign 0.35
R2147:Ubr1 UTSW 2 120,694,811 (GRCm39) missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120,756,528 (GRCm39) missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120,739,963 (GRCm39) missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120,793,929 (GRCm39) missense probably benign 0.02
R3930:Ubr1 UTSW 2 120,746,951 (GRCm39) missense probably benign 0.20
R3979:Ubr1 UTSW 2 120,693,168 (GRCm39) missense probably benign 0.11
R4172:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4173:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4174:Ubr1 UTSW 2 120,777,103 (GRCm39) splice site probably null
R4366:Ubr1 UTSW 2 120,801,084 (GRCm39) utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120,725,547 (GRCm39) splice site probably null
R4449:Ubr1 UTSW 2 120,776,862 (GRCm39) missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120,772,963 (GRCm39) missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120,756,494 (GRCm39) missense probably benign 0.35
R4765:Ubr1 UTSW 2 120,793,923 (GRCm39) nonsense probably null
R4928:Ubr1 UTSW 2 120,745,419 (GRCm39) missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120,794,047 (GRCm39) missense probably benign 0.00
R5033:Ubr1 UTSW 2 120,742,478 (GRCm39) critical splice donor site probably null
R5108:Ubr1 UTSW 2 120,793,903 (GRCm39) missense probably benign 0.20
R5118:Ubr1 UTSW 2 120,712,745 (GRCm39) missense probably benign 0.20
R5211:Ubr1 UTSW 2 120,723,651 (GRCm39) missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120,734,525 (GRCm39) missense probably benign 0.00
R5449:Ubr1 UTSW 2 120,793,981 (GRCm39) missense probably benign
R5452:Ubr1 UTSW 2 120,698,783 (GRCm39) missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120,745,888 (GRCm39) missense probably benign
R5610:Ubr1 UTSW 2 120,722,593 (GRCm39) missense probably benign 0.04
R5637:Ubr1 UTSW 2 120,793,998 (GRCm39) missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120,791,573 (GRCm39) missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120,734,486 (GRCm39) missense probably benign
R5979:Ubr1 UTSW 2 120,776,863 (GRCm39) missense probably benign 0.07
R6044:Ubr1 UTSW 2 120,693,202 (GRCm39) missense probably benign 0.38
R6146:Ubr1 UTSW 2 120,723,690 (GRCm39) missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120,737,376 (GRCm39) missense probably benign 0.21
R6389:Ubr1 UTSW 2 120,711,520 (GRCm39) missense probably benign 0.03
R6600:Ubr1 UTSW 2 120,745,880 (GRCm39) missense probably benign 0.00
R6670:Ubr1 UTSW 2 120,754,611 (GRCm39) critical splice donor site probably null
R6731:Ubr1 UTSW 2 120,786,121 (GRCm39) missense probably null 0.99
R6836:Ubr1 UTSW 2 120,727,156 (GRCm39) splice site probably null
R6994:Ubr1 UTSW 2 120,794,074 (GRCm39) missense probably benign
R7121:Ubr1 UTSW 2 120,705,979 (GRCm39) missense probably benign 0.00
R7204:Ubr1 UTSW 2 120,734,558 (GRCm39) missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120,693,246 (GRCm39) missense probably benign 0.04
R7434:Ubr1 UTSW 2 120,693,161 (GRCm39) missense probably benign
R7457:Ubr1 UTSW 2 120,748,309 (GRCm39) missense probably benign 0.35
R7464:Ubr1 UTSW 2 120,720,255 (GRCm39) critical splice donor site probably null
R7519:Ubr1 UTSW 2 120,705,925 (GRCm39) missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120,703,672 (GRCm39) missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120,764,855 (GRCm39) missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120,764,898 (GRCm39) nonsense probably null
R8221:Ubr1 UTSW 2 120,791,585 (GRCm39) missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120,793,937 (GRCm39) missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120,741,596 (GRCm39) missense probably benign
R8293:Ubr1 UTSW 2 120,693,202 (GRCm39) missense probably benign 0.38
R8420:Ubr1 UTSW 2 120,701,476 (GRCm39) missense probably benign
R8489:Ubr1 UTSW 2 120,711,548 (GRCm39) missense probably benign 0.42
R8708:Ubr1 UTSW 2 120,696,964 (GRCm39) missense probably benign 0.27
R8856:Ubr1 UTSW 2 120,734,523 (GRCm39) missense probably damaging 1.00
R8995:Ubr1 UTSW 2 120,697,034 (GRCm39) missense probably damaging 1.00
R9153:Ubr1 UTSW 2 120,756,469 (GRCm39) missense probably benign 0.00
R9155:Ubr1 UTSW 2 120,754,615 (GRCm39) missense possibly damaging 0.84
R9156:Ubr1 UTSW 2 120,703,603 (GRCm39) critical splice donor site probably null
R9194:Ubr1 UTSW 2 120,778,325 (GRCm39) missense probably damaging 1.00
R9320:Ubr1 UTSW 2 120,727,000 (GRCm39) missense probably benign 0.04
R9401:Ubr1 UTSW 2 120,765,765 (GRCm39) missense probably benign 0.06
R9430:Ubr1 UTSW 2 120,734,506 (GRCm39) missense possibly damaging 0.59
R9515:Ubr1 UTSW 2 120,703,627 (GRCm39) missense probably damaging 1.00
R9623:Ubr1 UTSW 2 120,764,820 (GRCm39) missense probably benign 0.06
R9703:Ubr1 UTSW 2 120,732,092 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCAGAGTCTGAGACACATTTTC -3'
(R):5'- GTGCACTAACTCACGTATTCTG -3'

Sequencing Primer
(F):5'- CAGAGTCTGAGACACATTTTCTAATC -3'
(R):5'- GCACTAACTCACGTATTCTGTATTG -3'
Posted On 2015-06-12