Incidental Mutation 'R4241:Btbd6'
ID320225
Institutional Source Beutler Lab
Gene Symbol Btbd6
Ensembl Gene ENSMUSG00000002803
Gene NameBTB (POZ) domain containing 6
Synonyms
MMRRC Submission 041058-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R4241 (G1)
Quality Score124
Status Validated
Chromosome12
Chromosomal Location112976482-112978945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 112976796 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 13 (A13V)
Ref Sequence ENSEMBL: ENSMUSP00000152889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002880] [ENSMUST00000011302] [ENSMUST00000165079] [ENSMUST00000221104] [ENSMUST00000221500] [ENSMUST00000222209] [ENSMUST00000223287] [ENSMUST00000223368]
Predicted Effect probably benign
Transcript: ENSMUST00000002880
AA Change: A64V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002880
Gene: ENSMUSG00000002803
AA Change: A64V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
low complexity region 58 68 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
BTB 137 237 1.39e-23 SMART
BACK 243 352 2.81e-14 SMART
Pfam:PHR 393 538 1.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000011302
SMART Domains Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 4 46 4.3e-17 PFAM
CYCLIN 91 172 1.93e-12 SMART
CYCLIN 185 269 1.22e-9 SMART
coiled coil region 298 334 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
Pfam:BRF1 452 545 3.3e-29 PFAM
low complexity region 638 650 N/A INTRINSIC
low complexity region 662 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165079
AA Change: A13V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127286
Gene: ENSMUSG00000002803
AA Change: A13V

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
BTB 86 186 1.39e-23 SMART
BACK 192 301 2.81e-14 SMART
Pfam:PHR 342 488 8.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220567
Predicted Effect probably benign
Transcript: ENSMUST00000221104
AA Change: A13V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221415
Predicted Effect unknown
Transcript: ENSMUST00000221500
AA Change: A13V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222117
Predicted Effect unknown
Transcript: ENSMUST00000222209
AA Change: A13V
Predicted Effect unknown
Transcript: ENSMUST00000223287
AA Change: A13V
Predicted Effect probably benign
Transcript: ENSMUST00000223368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223506
Predicted Effect probably benign
Transcript: ENSMUST00000223508
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,154,335 S1575G probably damaging Het
Agl A T 3: 116,754,848 probably benign Het
Ap5b1 C T 19: 5,568,797 L82F possibly damaging Het
Arfgef3 A G 10: 18,625,164 S1113P probably damaging Het
Atoh1 A C 6: 64,729,774 N151T probably damaging Het
Bcas3 T A 11: 85,470,826 S25R probably damaging Het
Blcap T A 2: 157,560,423 probably benign Het
Ccdc83 A C 7: 90,247,138 N74K probably damaging Het
Cdh9 A G 15: 16,849,079 probably null Het
Chd1 C T 17: 15,770,027 R1614* probably null Het
Col16a1 G T 4: 130,099,050 Q1567H probably damaging Het
Coq6 A T 12: 84,373,789 probably benign Het
Cpd T C 11: 76,846,785 D61G probably benign Het
Csnk1e A G 15: 79,424,895 F277S probably damaging Het
Cyp2d41-ps T A 15: 82,779,586 noncoding transcript Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Eif3e G A 15: 43,262,690 T287I probably damaging Het
Gm7135 A G 1: 97,353,953 noncoding transcript Het
Gpr176 A T 2: 118,279,610 S389R probably benign Het
Hax1 A G 3: 89,995,690 S257P probably damaging Het
Herc1 CTGAGGACTCTTTG CTG 9: 66,448,348 probably null Het
Ighv1-53 C T 12: 115,158,822 C5Y probably benign Het
Klhl13 T A X: 23,315,175 D2V probably damaging Het
Kynu A T 2: 43,681,410 H446L probably benign Het
Lingo1 A G 9: 56,620,102 F401S probably damaging Het
Lmbrd1 C T 1: 24,692,968 Q89* probably null Het
Mov10 T A 3: 104,797,276 Q773L probably benign Het
Olfr1356 T A 10: 78,847,905 R3S probably benign Het
Olfr596 G T 7: 103,310,661 *313Y probably null Het
Pde6c G A 19: 38,162,845 G608S probably damaging Het
Peli3 T C 19: 4,932,398 H413R probably damaging Het
Pkdrej C T 15: 85,818,144 R1197Q probably damaging Het
Rcan2 T A 17: 43,953,479 V10D probably benign Het
Slc10a5 A G 3: 10,335,460 S47P probably damaging Het
Sprr3 A G 3: 92,456,907 V210A possibly damaging Het
Tcerg1l G T 7: 138,397,632 Q8K unknown Het
Ubfd1 T C 7: 122,071,754 V265A possibly damaging Het
Ubr1 T C 2: 120,934,386 D529G possibly damaging Het
Vmn1r180 A T 7: 23,952,873 I154F probably damaging Het
Vmn1r237 A G 17: 21,314,663 H216R possibly damaging Het
Whrn C T 4: 63,432,973 probably benign Het
Zfr T G 15: 12,149,659 D388E probably damaging Het
Zic5 T C 14: 122,464,663 I219V probably benign Het
Zmat5 A G 11: 4,728,614 N53D probably benign Het
Other mutations in Btbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02264:Btbd6 APN 12 112976969 missense probably damaging 1.00
IGL03098:Btbd6 UTSW 12 112978418 missense probably damaging 1.00
R0544:Btbd6 UTSW 12 112977082 missense probably damaging 1.00
R2065:Btbd6 UTSW 12 112978135 missense probably damaging 1.00
R2424:Btbd6 UTSW 12 112978360 missense probably benign 0.00
R5363:Btbd6 UTSW 12 112978136 missense probably damaging 1.00
R6478:Btbd6 UTSW 12 112977312 unclassified probably benign
R7063:Btbd6 UTSW 12 112977512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACGCACAGTGACGAGAG -3'
(R):5'- ATGGAAGGACTGCCAGTTGG -3'

Sequencing Primer
(F):5'- CACAGTGACGAGAGACGCC -3'
(R):5'- CCAGTTGGGGCTCTCGG -3'
Posted On2015-06-12