Incidental Mutation 'R4243:Cpne9'
ID320294
Institutional Source Beutler Lab
Gene Symbol Cpne9
Ensembl Gene ENSMUSG00000030270
Gene Namecopine family member IX
Synonyms
MMRRC Submission 041643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R4243 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113282307-113305627 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 113283023 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000041203] [ENSMUST00000113146] [ENSMUST00000129883] [ENSMUST00000130191] [ENSMUST00000134945]
Predicted Effect probably benign
Transcript: ENSMUST00000041203
SMART Domains Protein: ENSMUSP00000044416
Gene: ENSMUSG00000030270

DomainStartEndE-ValueType
C2 14 122 2.12e-10 SMART
C2 143 257 5.15e-9 SMART
VWA 297 495 4.4e-10 SMART
low complexity region 536 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113146
SMART Domains Protein: ENSMUSP00000108771
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:C2 605 647 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128148
Predicted Effect probably benign
Transcript: ENSMUST00000129883
SMART Domains Protein: ENSMUSP00000114575
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130191
AA Change: P44L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132372
Predicted Effect probably benign
Transcript: ENSMUST00000134945
SMART Domains Protein: ENSMUSP00000118001
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:C2 221 256 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138388
Predicted Effect probably benign
Transcript: ENSMUST00000148523
SMART Domains Protein: ENSMUSP00000115808
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
Pfam:Myotub-related 1 102 4.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204050
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500011B03Rik C A 5: 114,813,794 R40L possibly damaging Het
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
4933409G03Rik C T 2: 68,593,543 probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Birc2 T C 9: 7,834,385 T32A probably benign Het
Cdh13 T A 8: 119,242,257 V451E probably damaging Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Cdt1 A G 8: 122,571,418 M383V probably benign Het
Chrna9 T C 5: 65,935,036 probably null Het
Cspg4 T C 9: 56,887,857 S959P probably benign Het
Ctbp2 A G 7: 132,998,854 I647T probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Ddx1 A T 12: 13,240,909 C68* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dynlt1b T C 17: 6,430,240 probably null Het
Faxc G A 4: 21,982,491 R310Q probably benign Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Frmd5 C A 2: 121,562,882 probably null Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Hspa12b C T 2: 131,141,858 H293Y possibly damaging Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Jkamp G A 12: 72,094,025 V108I probably benign Het
Mettl23 T C 11: 116,848,300 V72A possibly damaging Het
Morc2b T A 17: 33,136,401 Y799F probably benign Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Mysm1 A G 4: 94,969,011 V120A probably benign Het
Nhlrc1 C T 13: 47,014,026 V252I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Olfr530 G A 7: 140,372,944 A222V probably benign Het
Olfr855 C A 9: 19,584,558 T7K probably damaging Het
Pard3 G A 8: 127,371,647 A390T probably benign Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Pkn2 T C 3: 142,820,578 N413D possibly damaging Het
Ppp1r12b T G 1: 134,782,108 probably benign Het
Ptprf A G 4: 118,226,452 probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rasa1 A G 13: 85,244,195 Y407H probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Stra6 G A 9: 58,143,026 A237T probably benign Het
Tor1aip2 A G 1: 156,065,436 E496G probably damaging Het
Usp47 A G 7: 112,108,629 D1294G probably damaging Het
Utp20 A G 10: 88,807,325 probably null Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zbtb40 C T 4: 137,018,549 A58T probably benign Het
Zfhx3 A G 8: 108,792,320 T25A probably damaging Het
Other mutations in Cpne9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Cpne9 APN 6 113293022 missense possibly damaging 0.54
IGL02318:Cpne9 APN 6 113293738 missense possibly damaging 0.74
IGL02800:Cpne9 APN 6 113302073 missense probably benign 0.40
IGL02819:Cpne9 APN 6 113300663 missense probably damaging 0.99
IGL03111:Cpne9 APN 6 113300610 missense possibly damaging 0.79
PIT4366001:Cpne9 UTSW 6 113294746 missense probably damaging 1.00
R0145:Cpne9 UTSW 6 113300601 missense probably damaging 0.97
R0319:Cpne9 UTSW 6 113294693 missense probably damaging 1.00
R0514:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R0586:Cpne9 UTSW 6 113295063 missense probably damaging 0.96
R0594:Cpne9 UTSW 6 113290400 splice site probably benign
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R4184:Cpne9 UTSW 6 113282457 unclassified probably benign
R4256:Cpne9 UTSW 6 113283023 unclassified probably benign
R4258:Cpne9 UTSW 6 113283023 unclassified probably benign
R4412:Cpne9 UTSW 6 113290001 missense possibly damaging 0.78
R4690:Cpne9 UTSW 6 113302055 missense probably damaging 1.00
R5062:Cpne9 UTSW 6 113304488 missense probably damaging 0.99
R5249:Cpne9 UTSW 6 113293073 splice site probably benign
R5437:Cpne9 UTSW 6 113304630 unclassified probably benign
R5523:Cpne9 UTSW 6 113290231 missense probably damaging 1.00
R5979:Cpne9 UTSW 6 113293749 missense probably benign 0.44
R6207:Cpne9 UTSW 6 113294773 missense possibly damaging 0.88
R6849:Cpne9 UTSW 6 113302118 missense probably damaging 0.98
R6989:Cpne9 UTSW 6 113300583 missense possibly damaging 0.95
R7376:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R7524:Cpne9 UTSW 6 113302064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGCCATTTGTCAGAGATGTC -3'
(R):5'- TGTTGTCAATCACCTCGGTTCG -3'

Sequencing Primer
(F):5'- AGAGATGTCTGATGTTGTCCTGAATG -3'
(R):5'- TCTGCGTGTGAAGCACCAC -3'
Posted On2015-06-12