Incidental Mutation 'R4244:Slc27a1'
ID320344
Institutional Source Beutler Lab
Gene Symbol Slc27a1
Ensembl Gene ENSMUSG00000031808
Gene Namesolute carrier family 27 (fatty acid transporter), member 1
SynonymsFatp, FATP1
MMRRC Submission 041060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4244 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71568882-71587302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71584973 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 535 (T535A)
Ref Sequence ENSEMBL: ENSMUSP00000148768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034267] [ENSMUST00000212889]
Predicted Effect probably benign
Transcript: ENSMUST00000034267
AA Change: T535A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034267
Gene: ENSMUSG00000031808
AA Change: T535A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
Pfam:AMP-binding 82 515 2.1e-71 PFAM
Pfam:AMP-binding_C 523 598 2.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212211
Predicted Effect probably benign
Transcript: ENSMUST00000212889
AA Change: T535A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Homozygous null mutants are protected from fat-induced insulin resistance and intramuscular accumulation of fatty acid metabolites without alterations in whole body adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,482,521 T551A probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Ap1g1 G A 8: 109,833,490 S281N probably benign Het
Arfgef3 C A 10: 18,630,420 G878V probably damaging Het
Ccdc137 T C 11: 120,462,018 F196S probably damaging Het
Ccdc18 C T 5: 108,148,972 Q214* probably null Het
Ccrl2 T C 9: 111,055,354 I359V probably benign Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Col6a3 G T 1: 90,786,639 T1683K unknown Het
Copa A G 1: 172,110,718 I524V probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dock5 A G 14: 67,774,582 F1348L probably benign Het
Efcab3 A T 11: 105,111,803 K5664I probably damaging Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Gm9892 A T 8: 52,196,400 noncoding transcript Het
Grm4 A G 17: 27,502,735 I144T probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Krt28 G T 11: 99,374,550 S97Y probably damaging Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mfsd2b G T 12: 4,874,356 probably benign Het
Nav3 T C 10: 109,769,296 D972G probably damaging Het
Olfr1167 T C 2: 88,149,288 T244A probably benign Het
Olfr131 C T 17: 38,082,430 V183I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Prex1 G A 2: 166,570,336 R392W probably damaging Het
Ptpn5 C T 7: 47,091,548 W38* probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sh3d21 C T 4: 126,150,718 probably benign Het
Slc5a5 A G 8: 70,890,286 V210A probably benign Het
Snx25 A G 8: 46,105,254 C239R probably damaging Het
Sp5 T C 2: 70,477,038 F356L probably damaging Het
Spaca9 T C 2: 28,692,986 I141V probably benign Het
Tbcd T A 11: 121,594,281 L763H probably damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Vwa5a T C 9: 38,737,816 probably benign Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Slc27a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc27a1 APN 8 71584772 critical splice donor site probably null
IGL02974:Slc27a1 APN 8 71584203 missense probably damaging 0.99
IGL03371:Slc27a1 APN 8 71585408 missense probably benign 0.20
R0178:Slc27a1 UTSW 8 71584462 missense possibly damaging 0.91
R0508:Slc27a1 UTSW 8 71580228 unclassified probably benign
R0600:Slc27a1 UTSW 8 71584164 missense probably damaging 1.00
R1169:Slc27a1 UTSW 8 71580653 missense probably benign 0.01
R1445:Slc27a1 UTSW 8 71584113 splice site probably null
R1708:Slc27a1 UTSW 8 71584630 splice site probably null
R1737:Slc27a1 UTSW 8 71570860 missense probably benign 0.05
R1850:Slc27a1 UTSW 8 71580703 critical splice donor site probably null
R2419:Slc27a1 UTSW 8 71579916 missense possibly damaging 0.81
R3817:Slc27a1 UTSW 8 71584478 missense probably damaging 1.00
R3967:Slc27a1 UTSW 8 71579787 missense probably damaging 1.00
R4243:Slc27a1 UTSW 8 71584973 missense probably benign 0.00
R4552:Slc27a1 UTSW 8 71580066 unclassified probably null
R4649:Slc27a1 UTSW 8 71570764 missense probably benign 0.11
R4748:Slc27a1 UTSW 8 71580675 missense probably damaging 0.97
R4748:Slc27a1 UTSW 8 71580809 missense possibly damaging 0.94
R5273:Slc27a1 UTSW 8 71584256 missense probably benign 0.07
R5913:Slc27a1 UTSW 8 71584263 missense probably benign 0.31
R6958:Slc27a1 UTSW 8 71585439 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGGCTGTCAGACTGCAAAGC -3'
(R):5'- TCTGATCCTGAGAAGGGGTC -3'

Sequencing Primer
(F):5'- TCAGACTGCAAAGCCCGGTC -3'
(R):5'- TTAGGAATGTGGATGGATTCCCAAC -3'
Posted On2015-06-12