Incidental Mutation 'R0396:Adamts9'
ID32036
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms8430403M15Rik, E030027K14Rik, 1810011L16Rik
MMRRC Submission 038602-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0396 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location92772699-92943492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92798005 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1676 (T1676S)
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]
Predicted Effect probably benign
Transcript: ENSMUST00000113438
AA Change: T1676S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: T1676S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125490
Predicted Effect probably benign
Transcript: ENSMUST00000167391
AA Change: T1095S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: T1095S

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,377 V467A possibly damaging Het
4933405L10Rik G A 8: 105,709,780 V194I probably benign Het
Acsm1 A T 7: 119,636,455 I133F probably damaging Het
Adcy4 T C 14: 55,772,288 D769G probably benign Het
Aif1 T C 17: 35,171,109 *148W probably null Het
Akna C T 4: 63,392,126 probably benign Het
Arhgap32 G A 9: 32,245,255 probably null Het
Atpaf1 G A 4: 115,785,252 E92K possibly damaging Het
C1s1 T C 6: 124,533,354 E378G probably benign Het
Caprin1 T A 2: 103,769,569 Q108L probably damaging Het
Car13 A T 3: 14,656,239 H154L probably benign Het
Cdon C A 9: 35,470,130 N605K probably damaging Het
Ceacam10 G A 7: 24,781,014 G70E probably damaging Het
Cfap221 G A 1: 119,954,200 T286M probably benign Het
Cfap61 T C 2: 145,949,944 F107S possibly damaging Het
Coil C A 11: 88,981,623 T270N probably benign Het
Crocc2 T G 1: 93,224,214 probably benign Het
Crot T C 5: 8,969,959 E461G probably damaging Het
D130052B06Rik G T 11: 33,623,391 R41L unknown Het
D630045J12Rik T C 6: 38,196,736 S166G possibly damaging Het
Dennd4a T G 9: 64,862,391 V460G probably damaging Het
Depdc7 A T 2: 104,727,323 probably benign Het
Dgkb G A 12: 38,190,135 probably null Het
Dhx57 T G 17: 80,274,797 S407R probably benign Het
Dnase2a G T 8: 84,909,763 probably benign Het
Dqx1 T G 6: 83,059,005 M106R probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Ephx2 T G 14: 66,108,063 I151L probably benign Het
Gdf3 C T 6: 122,607,135 G91D probably damaging Het
Gm14124 G A 2: 150,268,053 G221D probably damaging Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gsdme T A 6: 50,221,107 H291L probably benign Het
H2-Bl A G 17: 36,083,722 I103T possibly damaging Het
Hif3a G A 7: 17,052,021 probably benign Het
Hmox2 A T 16: 4,765,763 I232L probably benign Het
Itgb2 A G 10: 77,561,189 Y686C probably damaging Het
Jmjd1c A G 10: 67,219,523 T528A possibly damaging Het
Kdr T C 5: 75,960,728 I541V possibly damaging Het
Khdrbs2 C A 1: 32,519,973 V343L probably damaging Het
Kif16b C T 2: 142,853,659 R175H probably damaging Het
Klri2 T G 6: 129,740,288 E44A possibly damaging Het
Kmt2b G T 7: 30,576,755 T1773K probably damaging Het
Lair1 A G 7: 4,010,786 L154P probably damaging Het
Larp1b G A 3: 40,970,561 V158M probably damaging Het
Lgi3 T A 14: 70,534,840 I275N probably damaging Het
Lrba A G 3: 86,295,179 N246D probably damaging Het
Lrrc45 T A 11: 120,714,907 probably benign Het
Mdh2 G T 5: 135,789,679 V263L probably benign Het
Myom1 T A 17: 71,034,693 V149E probably damaging Het
Nanos1 A T 19: 60,757,041 D259V probably damaging Het
Nedd4l T A 18: 65,161,654 probably benign Het
Npas3 A G 12: 53,831,745 Y150C probably damaging Het
Olfr1066 T C 2: 86,456,019 N84S possibly damaging Het
Olfr1129 T A 2: 87,575,567 V161D possibly damaging Het
Olfr1392 A T 11: 49,293,338 I6F probably benign Het
Olfr479 A T 7: 108,055,963 H327L probably benign Het
Olfr672 G A 7: 104,996,706 A66V probably damaging Het
Olfr93 C T 17: 37,151,555 C139Y probably damaging Het
Pde4c A G 8: 70,750,076 N637S probably benign Het
Pds5b T A 5: 150,779,275 V824D possibly damaging Het
Pole2 A T 12: 69,222,386 probably benign Het
Ppig C T 2: 69,735,976 probably benign Het
Prep A G 10: 45,092,676 Y90C probably damaging Het
Proca1 A T 11: 78,194,905 R11S probably damaging Het
Prph T A 15: 99,056,991 W313R probably benign Het
Prune2 C T 19: 17,123,080 P1983S probably benign Het
Ptbp2 G A 3: 119,724,198 probably benign Het
Rsph6a C T 7: 19,074,106 P398L probably damaging Het
Sdk2 T C 11: 113,829,967 I1379V probably benign Het
Sf3b1 C T 1: 55,019,271 G53E probably damaging Het
Slc9a3 T C 13: 74,157,784 probably null Het
Smarcal1 A T 1: 72,626,473 H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,150,707 probably benign Het
Sptan1 T C 2: 29,991,033 V438A probably damaging Het
Sstr4 T A 2: 148,396,261 V264D probably damaging Het
Susd2 A G 10: 75,639,911 L418P probably damaging Het
Synj1 A G 16: 90,938,640 V1475A probably benign Het
Szt2 G A 4: 118,376,347 probably benign Het
Tbc1d4 T C 14: 101,458,063 probably null Het
Tesk1 A G 4: 43,446,000 E311G probably damaging Het
Tmed5 A T 5: 108,126,016 V119E probably damaging Het
Tmem260 T C 14: 48,486,867 S201P possibly damaging Het
Tnxb A G 17: 34,671,733 Y350C probably damaging Het
Tpte T C 8: 22,335,608 probably benign Het
Trim37 A T 11: 87,146,968 D161V probably damaging Het
Trrap C A 5: 144,814,556 Q1640K probably damaging Het
Tspoap1 T C 11: 87,776,346 probably benign Het
Ttk T A 9: 83,847,260 probably benign Het
Vmn1r172 A G 7: 23,660,532 S281G probably benign Het
Vmn1r177 A G 7: 23,865,597 S285P probably damaging Het
Vmn1r231 C T 17: 20,890,399 V85I probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r118 T C 17: 55,608,643 I436V probably benign Het
Vmn2r12 T C 5: 109,092,899 K116R probably benign Het
Vmn2r28 T A 7: 5,488,514 I245L probably benign Het
Wdr26 A T 1: 181,180,651 probably benign Het
Xrcc3 A T 12: 111,809,957 H67Q probably benign Het
Zbbx A T 3: 75,078,495 S417T possibly damaging Het
Zc3h13 A G 14: 75,323,482 D504G unknown Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zyg11b A T 4: 108,255,308 F388I probably damaging Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92859902 missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92860174 missense probably benign 0.00
IGL01462:Adamts9 APN 6 92894266 missense probably benign 0.04
IGL01551:Adamts9 APN 6 92807020 missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92858147 splice site probably benign
IGL01638:Adamts9 APN 6 92872428 missense probably benign 0.19
IGL01757:Adamts9 APN 6 92796159 missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92777439 missense probably benign 0.00
IGL02379:Adamts9 APN 6 92797033 missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92796997 missense probably benign 0.04
IGL02554:Adamts9 APN 6 92880847 missense probably benign 0.01
IGL02832:Adamts9 APN 6 92807175 missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92889937 missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92887432 nonsense probably null
IGL03401:Adamts9 APN 6 92786868 missense probably damaging 0.97
Bluebeard UTSW 6 92879959 nonsense probably null
PIT4402001:Adamts9 UTSW 6 92872347 missense probably benign
PIT4458001:Adamts9 UTSW 6 92889905 missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0067:Adamts9 UTSW 6 92890167 missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92943085 missense probably benign
R0326:Adamts9 UTSW 6 92858057 nonsense probably null
R0490:Adamts9 UTSW 6 92872866 missense probably benign
R0504:Adamts9 UTSW 6 92912645 missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92858113 missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92880957 missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92903802 missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92796433 missense probably benign
R1433:Adamts9 UTSW 6 92849290 critical splice donor site probably null
R1558:Adamts9 UTSW 6 92908711 missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92880623 missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92863376 missense probably benign 0.27
R1855:Adamts9 UTSW 6 92901369 splice site probably benign
R1887:Adamts9 UTSW 6 92872788 critical splice donor site probably null
R1934:Adamts9 UTSW 6 92943121 missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92859849 missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92796394 missense probably benign
R2370:Adamts9 UTSW 6 92860203 missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92912831 missense probably benign
R2432:Adamts9 UTSW 6 92857900 missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92795910 splice site probably benign
R3015:Adamts9 UTSW 6 92872932 missense probably benign 0.05
R3611:Adamts9 UTSW 6 92869984 missense probably benign 0.05
R4024:Adamts9 UTSW 6 92872784 splice site probably benign
R4292:Adamts9 UTSW 6 92795996 missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92859864 missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92879959 nonsense probably null
R4677:Adamts9 UTSW 6 92816606 start codon destroyed probably null
R5114:Adamts9 UTSW 6 92890273 missense probably benign 0.03
R5260:Adamts9 UTSW 6 92807137 missense probably benign 0.00
R5384:Adamts9 UTSW 6 92798018 missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92880697 missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92854365 missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92798133 missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92903786 missense probably benign 0.02
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92859926 missense possibly damaging 0.83
R6051:Adamts9 UTSW 6 92890118 missense probably damaging 1.00
R6082:Adamts9 UTSW 6 92889949 missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92797021 missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92890120 missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92872335 missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92905191 missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92863354 missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92909793 nonsense probably null
R7095:Adamts9 UTSW 6 92887691 missense probably benign 0.39
R7287:Adamts9 UTSW 6 92890003 missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92894289 missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92858121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAGGACAAACCTTGGCAAC -3'
(R):5'- GCCGTGGGAAATCTCTGACACATC -3'

Sequencing Primer
(F):5'- AACTTGCAGTTTCCTTGGATGAAG -3'
(R):5'- GGAAATCTCTGACACATCCCCTC -3'
Posted On2013-04-24